1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiks02 [169]
2 years ago
15

Explain heredity in detail​

Biology
2 answers:
solniwko [45]2 years ago
3 0

Answer:

<em>H</em><em>eredity, the sum of all biological processes by which particular characteristics are transmitted from parents to their offspring. ... Each offspring is a combination of its two parents, receiving some dominant traits from its mother and others from its father.</em>

Explanation:

<h3>I hope this helps!</h3>
docker41 [41]2 years ago
3 0

Answer:

Heredity, the sum of all biological processes by which particular characteristics are transmitted from parents to their offspring. ... Each offspring is a combination of its two parents, receiving some dominant traits from its mother and others from its father.

Explanation:

<h3>I hope this helps!</h3>
You might be interested in
What are two main groups of plants?
Daniel [21]

Answer:

Plants are classified within the domain Eukaryota. Two major groups of plants are green algae and embryophytes (land plants).

8 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Which of the following is true about glassy igneous rocks?
Evgesh-ka [11]
Glassy igneous rocks (i.e. obsidian) are cooled very rapidly.
6 0
3 years ago
Drag the tiles to the correct boxes to complete the palrs.
Vikki [24]

Answer:

Clogging engine cooling systems - Bra Mussels

Extinction of bandicoots - Feral Cats

Blocking water boats - Water Hyacinths

Hope this helps :)

6 0
3 years ago
Read 2 more answers
Inflammation of vein
Inessa [10]
The answer is Phlebitis
5 0
2 years ago
Read 2 more answers
Other questions:
  • The esophagus and trachea are both open to the ______.
    13·2 answers
  • Imagine a plant without phloem. for sugars to move from one region of the plant to another, what must happen?
    9·1 answer
  • 40 POINTS PLZ HELP If a mutation occurred and cells no longer received a signal to stop reproducing, __ would occur.
    7·2 answers
  • Describe how education level affects the fertility rate in Africa and how this in turn affects the annual growth rate.
    10·2 answers
  • The disease called ___________ is caused by excessive secretion of glucocorticoids, and is characterized by redistribution of bo
    9·1 answer
  • In DNA, the nitrogen bases pair up. The correct pairing is __________ with _________, and ________ with _________. *
    12·1 answer
  • Ally is a junior high student who has just learned about the carbon cycle in school. She is concerned about the environment and
    9·1 answer
  • The lubber grasshopper is a very large grasshopper, and is black with red and yellow
    8·1 answer
  • 10. Compare animal and plant cells.
    9·1 answer
  • What part of the neuron releases neurotransmitters
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!