Explain heredity in detail

Biology

2 answers:

solniwko [45]2 years ago

3 0

Answer:

<em>H</em><em>eredity, the sum of all biological processes by which particular characteristics are transmitted from parents to their offspring. ... Each offspring is a combination of its two parents, receiving some dominant traits from its mother and others from its father.</em>

Explanation:

<h3>I hope this helps!</h3>

docker41 [41]2 years ago

3 0

Answer:

Heredity, the sum of all biological processes by which particular characteristics are transmitted from parents to their offspring. ... Each offspring is a combination of its two parents, receiving some dominant traits from its mother and others from its father.

Explanation:

<h3>I hope this helps!</h3>

You might be interested in

What are two main groups of plants?

Daniel [21]

Answer:

Plants are classified within the domain Eukaryota. Two major groups of plants are green algae and embryophytes (land plants).

8 0

3 years ago

The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

liubo4ka [24]

The mRNA generated below was produced in the <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.