1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
2 years ago
9

What role do guanacos play in the Andes Mountains ecosystem?.

Chemistry
1 answer:
Nikitich [7]2 years ago
5 0

Grasses and plants are producers, guanacos are herbivores and are primary consumers and pumas are predators and secondary consumers

You might be interested in
A solution is known to contain an inorganic salt of one of the following elements. The solution is colorless. The solution conta
Lisa [10]
I thimk the answer of the question is mn

6 0
3 years ago
Read 2 more answers
C3H8 + 2O2 → <br> I don’t known what this equation reacts to make
djyliett [7]
It is a combustion reaction. C3H8 will react with oxygen to form carbon dioxide and water.
8 0
3 years ago
What type of wave do the contractions of the snake muscles make as the snake moves forward
S_A_V [24]
Actually, there are four kinds of reptile motion: 

Concertina - vermiform. Circular muscles around the snake squeeze the front of the snake's body out long, then the latter half is pulled forward. 

Rectilinear crawling - Belly scutes are moved forward individually in a wave-like motion. 

Side-winding - Snake's version of "walking". Use by several species to move over fluidic substrates, such as sand. 

Lateral undulation - Most common form of movement. Snake presses on alternating pressure points to force body forward (or backward)

(taken from a user on Yahoo from Correct Answers)
3 0
3 years ago
Which of the following best describes earth tectonic plates ?
meriva

Answer:

B They move because of the convection currents in the mantle.

6 0
2 years ago
Read 2 more answers
Which of the following is an anion?Al3+ Mg2+ O2– H Save
JulijaS [17]
An anion is an ion with a negative charge. The minus sign, when attached to the end of an ionic compound, indicates that this has a negative charge, while a plus sign indicates a positive charge. 

O2- is the only compound listed that satisfied this. It is the anion.
Answer is 02-
5 0
3 years ago
Other questions:
  • A ______ property describes how a substance acts when it reacts with other substances.
    8·2 answers
  • What is the correct definition of density
    8·2 answers
  • Why is nitrogen fixation such an important step in the nitrogen cycle?
    15·1 answer
  • The color change of an indicator is used to determine ​
    9·1 answer
  • PLEASE HELP AND DO NOT SEND A LINK IF YOU DO YOU WILL BE REPORTED
    10·1 answer
  • Write the overall balanced equation for the reaction:<br><br> N2O4(g) + CO → NO(g) + CO2(g)+NO2(g)
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Why are science safety rules important? PLZ DO NOT COPY AND PASTE
    13·1 answer
  • How many moles of xenon gas are necessary to exert a 0.64atm pressure in an 8.5L container at 300.0K?
    6·2 answers
  • What is the mass grams that are in 2.57 × 10²⁵ molecules of I₂
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!