1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sleet_krkn [62]
3 years ago
13

Indicate which statements are true of proteins. Select all that apply. Multiple select question. They act as receptors on cells'

surfaces. They catalyze chemical reactions. They make up molecules that can transport oxygen. They make up one of the subunits, or building blocks, of triglycerides. They carry the instructions that control a cell's activities.
Biology
1 answer:
il63 [147K]3 years ago
8 0

Answer:

React on cell surfaces, catalyze reactions.

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
When the animal cells undergo cell division, several cellular structures aid the movement of chromosomes into the two new daught
Nitella [24]

i pretty sure its Cytokinesis and Spindle Fibers.


3 0
3 years ago
Which biome typically experinces hot summers cold winters and lots of rain
photoshop1234 [79]
Temperate Diciduous forest Biome
5 0
4 years ago
Question 4 (1 point)
disa [49]

Answer: status symbols

Explanation:

Status symbols are simply referred to as the objects that shows the social class or economic position of a person.

With regards to the information given in the question, we can see that the pointy-toed boots, a silk scarf, a pair of Wranglers, and a cowboy hat were used to show the status of the cowboy.

5 0
3 years ago
Science-what is the correct arrange of this E,M,A,I,H,T,P,C,M,E,R​
Mariana [72]

Answer:

Champetre, imprecate, metameric, Hemiptera ??

Explanation: Choose I'm out of ideas xD

4 0
3 years ago
Other questions:
  • Skin tanning is an example of which adaptation technique?
    12·1 answer
  • "Cell theory has two main parts: every living organism is composed of one or more cells, and all cells living today came from a
    12·1 answer
  • If your grandparents are coming over for a couple of weeks, and they would like to know what is the weather there, what question
    12·1 answer
  • How is mitosis different in plants and animals
    15·2 answers
  • Translation is divided into three phases: initiation, elongation, and termination. In this tutorial you will gain an understandi
    11·1 answer
  • Cite a reason for the evolution of allosteric regulators in cells.
    8·1 answer
  • Which of the following best describes the process of diffusion?
    11·2 answers
  • Geothermal energy works best in regions where
    10·1 answer
  • What ratio of plants in the offspring would you predict from a Yy x Yy cross?
    6·1 answer
  • 3) Will there come a time when you can agree to population control in the US? Why or Why not?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!