1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
2 years ago
11

Functions of microscope​

Biology
1 answer:
Elan Coil [88]2 years ago
7 0

Answer:

used to observe small objects, even cells

Explanation:

The image of an object is magnified through at least one lens in the microscope.

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Nomextm and kevlartm are polyamides that are unusually tough and flame resistant. what structural feature makes nomex and kevlar
morpeh [17]
Monomers that include aromatic rings. 
6 0
3 years ago
Read 2 more answers
You need to remove a broken light bulb from a lamp. Without a pair of gloves, you are likely to cut yourself on the jagged glass
soldi70 [24.7K]

Answer:

The correct answer is insight learning.

Explanation:

A kind of problem-solving or learning, which takes place instantaneously by comprehending the various aspects of an issue in spite of going through trial and error procedure is termed as insight learning. The given case is a clear illustration of insight learning. This form of learning takes place if one finds a novel way to solve an issue without the help of any other elements.  

The individual in the given case used the help of a cut potato to collect the broken pieces of a lamp, which is an illustration of insight learning. The person has used his instinct and has not used any outside source for doing what he had done.  

4 0
3 years ago
Name the process in animals which requires meiosis to take place
grin007 [14]
Sexual reproduction is the process in animals that requires meiosis to take place. It does not matter whether the animal is single celled or multi celled. Meiosis is the type of cell division in which four daughter cells are formed with half the number of chromosomes of the original orthe parent cell. The perfect example of meiosis is the formation of gamets and spores. Meiosis is the process that helps in the formation of male and female reproductive cells like the sperm and the eggs. Meiosis is totally different from mitosis.
3 0
2 years ago
Liquefaction occurs when _____. large waves wash over coastal areas and destroy structures mud slides swiftly downhill and burie
saw5 [17]

The answer is; saturated soil turns into liquid that can't support buildings


Soil liquefaction occurs mainly in soils saturated, or partially saturated, with water such as in wetlands. During an earthquake, the waves pass through the soil and make it behave like a wave in a fluid. This causes the soil to loosen temporarily and become weak. The foundation of buildings in the soil fail and the structures collapse.


8 0
3 years ago
Read 2 more answers
Other questions:
  • When two people use the same dichotomous key to identify the same object is it possible (should it be possible) for them to have
    12·1 answer
  • When automobiles burn gasoline, they release many pollutants including sulfur oxides into the air. the release of sulfur oxides
    10·1 answer
  • The shoulder is _to the elbow
    12·1 answer
  • Which of the following statements is most true regarding macromolecules and their functions?
    12·2 answers
  • What happens during photosynthesis
    8·2 answers
  • which of the following individuals is most likely to allow a recessive lethal gene to be kept in a population over several gener
    14·2 answers
  • Is the Great Green Wall an example of Secondary Succession?
    15·1 answer
  • Explain how the routine visit of a 5-year-old patient may be
    15·2 answers
  • PLEASE HELP!! Which of the following happens when cancer occurs?
    12·1 answer
  • Describe the chemical composition of bone.<br><br> please answer in your own words
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!