1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
2 years ago
9

Fill in the coefficients to balance the equation for the chemical reaction that occurs:

Chemistry
1 answer:
Dominik [7]2 years ago
8 0

Answer:

The equation is balanced

Explanation:

NaCl (aq) + AgNO3(aq) ––> AgCl (s) + NaNO3 (aq)

NaCl (aq) + AgNO3 (aq)

Na = 1 , Cl=1 , Ag = 1 , No3= 1

AgCl (s) + NaNO3 (aq)

Ag = 1 , Cl=1 , Na = 1 , No3= 1

You might be interested in
Give free 18 points again just answer yes or no<br> is einstein a scientist? yes or no
BARSIC [14]

Answer:

yes

Explanation:

8 0
2 years ago
Read 2 more answers
I need help with homework
stellarik [79]

The equation that conforms with the particle model is 4C + 6O2 ----> 4CO2 + 2O2.

<h3>What is a chemical reaction?</h3>

The term chemical reaction has to do with the combination of substances to give products. We know that reactants and products must follow the law of conservation of mass.

Hence, the equation that conforms with the particle model is 4C + 6O2 ----> 4CO2 + 2O2.

Learn more about chemical reaction:brainly.com/question/22817140

#SPJ1

4 0
1 year ago
I need this answer quick please show work
Ainat [17]

Answer:

The answer to your question is 25.2 g of acetic acid.

Explanation:

Data

[Acetic acid] = 0.839 M

Volume = 0.5 L

Molecular weight = 60.05 g/mol

Process

1.- Calculate the number of moles of acetic acid

    Molarity = moles / volume

-Solve for moles

    moles = Molarity x volume

-Substitution

    moles = (0.839)(0.5)

-Result

    moles = 0.4195

2.- Calculate the mass of acetic acid using proportions and cross multiplications

                   60.05 g ----------------------- 1 mol

                        x        ----------------------- 0.4195 moles

                        x = (0.4195 x 60.05) / 1

                        x = 25.19 g

3.- Conclusion

25.2 g are needed to prepare 0.500 L of Acetic acid 0.839M

               

4 0
3 years ago
An open "empty" 2 L plastic pop container, which has an actual inside volume of 2.05 L, is removed from a refrigerator at 5 °C a
Pani-rosa [81]

2.168 L of air will leave the container as it warms

<h3>Further explanation</h3>

Given

V₁=2.05 L

T₁ = 5 + 273 = 278 K

T₂ = 21 + 273 = 294 K

Required

Volume of air

Solution

Charles's Law  

When the gas pressure is kept constant, the gas volume is proportional to the temperature  

\tt \dfrac{V_1}{T_1}=\dfrac{V_2}{T_2}

Input the value :

V₂=(V₁.T₂)/T₁

V₂=(2.05 x 294)/278

V₂=2.168 L

3 0
3 years ago
Pedigree charts use shaded symbols to show organisms that have a particular trait, such as a defective gene, being traced in the
Ulleksa [173]
Males are represented my a square
if he is affected by a defective gene he should show a shaded square that differs from normal males just like this■
5 0
2 years ago
Read 2 more answers
Other questions:
  • Describe the properties of Cooper
    14·2 answers
  • What happened to the reaction below
    14·1 answer
  • calculate density of a rectangular solid, which has a mass of 25.71 g. It is 2.30 cm long, 4.01 cm wide and 1.82 cm high.
    9·1 answer
  • What is the coefficient of diphosphorus trioxide? (p2o3)
    10·1 answer
  • How many electrons are in polonium with a -3 charge?
    15·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Filtration, devastation, and evaporation are examples of
    7·1 answer
  • Some of the enzymes that oxidize sugars to yield useable cellular energy (for example, ATP) are regulated by phosphorylation. Fo
    13·1 answer
  • All substances can be put in the trash for disposal. True or false
    6·1 answer
  • The chemical reactions between limestone and acid in the groundwater form. A) geysers B) wetlands C) volcanoes D) sinkholes ​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!