1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
2 years ago
8

Match the organism to the correct description.

Biology
2 answers:
Monica [59]2 years ago
5 0

Marmots is a primary consumer

Mosses are producers

Lynx is predator

Dung cannon is decomposers

Hope this helps.

Brainliest?

nikitadnepr [17]2 years ago
4 0
Marmots is a primary consumer

Mosses are producers

Lynx is predator

Dung cannon is decomposers
You might be interested in
What two substances are the ingredients of cellular respiration and the products of photosynthesis?
solong [7]

Answer: Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Hope this helps... Stay safe and have a great day/night!!!!! :D

8 0
3 years ago
Read 2 more answers
What type of cell undergoes meiosis
gayaneshka [121]

In multicellular plants and animals, however, meiosis is restricted to the germ cells, where it is key to sexual reproduction. Whereas somatic cells undergo mitosis to proliferate, the germ cells undergo meiosis to produce haploid gametes (the sperm and the egg).

4 0
3 years ago
Read 2 more answers
Waters slightly positive and negative charges make it a universal _________.
Viktor [21]
Universal solvent is the answer
4 0
3 years ago
Directions: Sort these words in these two categories.
denis23 [38]

Answer: Positive effects: Disease prevention, agriculture, transplants, pharmaceuticals

Negative: Herbicides, pesticides, mutations

Explanation:

8 0
3 years ago
Read 2 more answers
Look at the speedometer at the top. What do you notice about the speed when the skater goes from a height of 6m down to 0m and b
iren [92.7K]

Answer:

First increases then decreases.

Explanation:

The speed of skater tends to increases when it moves from high elevation of 6 m to the low height area due to sloppy region while on the other hand, when the skater moves again from 0 m or from the ground level to 6 m height its speed decreases when reaches to the highest point. First the speed of the skater increases due to moving in the direction of gravity while on other hand, the speed of the skater decreases due to movement of skater against the gravity of earth.

5 0
2 years ago
Other questions:
  • List three factors that could affect the reproductive potential of these maple trees
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A gene that normally has the sequence CAGAGCCTATTAGGC is replicated as CAGAGCTTATTAGGC. Which of the following repair mechanisms
    7·1 answer
  • How are the building blocks of organic molecules like bricks?
    5·1 answer
  • ____________ epithelium can function in diffusion, filtration, secretion and protection based on location.
    8·1 answer
  • Cuáles son los alimentos que se deben consumir en menor cantidad
    12·1 answer
  • How did the Tang and Song dynasties differ from the later Ming dynasty?
    14·1 answer
  • Brainly would not accept my question the way I stated it, so I took a screenshot of it. Can someone please answer it for me and
    14·1 answer
  • What must be true for a male individual to be a carrier of a Y-linked recessive allele?
    6·1 answer
  • How can you detect hardness of water collected from different sources​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!