1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly [62]
2 years ago
8

Match the organism to the correct description.

Biology
2 answers:
Monica [59]2 years ago
5 0

Marmots is a primary consumer

Mosses are producers

Lynx is predator

Dung cannon is decomposers

Hope this helps.

Brainliest?

nikitadnepr [17]2 years ago
4 0
Marmots is a primary consumer

Mosses are producers

Lynx is predator

Dung cannon is decomposers
You might be interested in
What is a difference between starch and glycogen?
deff fn [24]

The right answer is B.

Starch is, along with cellulose, the most common polysaccharide in the plant world. It constitutes the essential energy reserves of plants and is a component of the diet of humans. It is part of the group of slow sugars. Its consumption is particularly recommended to those who practice a sport.

Glycogen, which is a polysaccharide, is the form in which carbohydrates are stored in the body (animals and fungi). Glycogen is broken down into glucose molecules when the body needs energy.

7 0
3 years ago
Read 2 more answers
Which of the following could be a nucleotide of DNA?
dsp73
A) Deoxyribose + phosphate group + thymine
8 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
What is an antonym for the word Marma?
8_murik_8 [283]

Answer:the word is not marma ok it karma ok

Explanation:I must saturate myself with repose and with the underlying—with Karma.

Karma is the Law of the Universe, the expression of divine Will.

And what have ye done to Karma, that he is so wet and silent?

How can one substitute here a sameness of Karma for identity of soul?

I soon discovered that, no matter how the wheel is turned, the Karma or merit is equal.

Equally unsatisfying is the statement that phenomena are aggregates of Karma.

6 0
2 years ago
A light wave traveling through air passes into a new medium. What can result when some of the waves energy is absorbed by the ne
WINSTONCH [101]

Answer:

The wave's energy decreases.

4 0
2 years ago
Other questions:
  • What is the difference between the pulmonary and systemic circulations
    8·1 answer
  • What atoms are present in each type of molecule
    9·1 answer
  • Which endocrine gland is indicated by the arrow? hypothalamus pituitary gland thyroid gland adrenal gland Its C thyroid
    12·2 answers
  • Why would you not test the affect on the amount of water and temperature on the germination of seeds at the same time pleeeaseee
    10·1 answer
  • About 90 percent of stars on the Hertzsprung-Russell (H-R) diagram are _____.
    14·2 answers
  • Reflex responses are controlled in your _____
    6·1 answer
  • Which of the following causes ozone depletion?
    9·2 answers
  • Pomuzcie z karto pracy i nie cała tylko zadania od drugiego
    6·1 answer
  • Briefly explain the characteristics of invertebrates?​
    7·1 answer
  • Does photosynthesis take place in animals, plants, or both animals and plants?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!