Budding is a type of asexual reproduction in which a new organism develops from an outgrowth or bud due to cell division at one particular site. ... Since the reproduction is asexual, the newly created organism is a clone and excepting mutations is genetically identical to the parent organism.

7 0

3 years ago

In an estuary, there is shallow, brackish water. What component of an estuary is this an example of?

Alona [7]

The answer is Habitat. The brackish water environment is formed due to the mixing of fresh water from the river with the salty waters of the ocean. This habitat is significant for fishes that come to spawn and feed. Crabs, mosquitoes and birds can also be found in this environment.

3 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What’s amnio acids mean

Andrews [41]

Answer:

Amino acids are organic compounds that combine to form proteins. Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids to make proteins to help the body: Break down food.

7 0

3 years ago