1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
2 years ago
7

What is the complementary DNA strand to ATGGCAT?

Biology
1 answer:
MatroZZZ [7]2 years ago
3 0

Answer:

TACCGTA

Explanation:

Thymine pairs with Adenine and guanine pairs with cytosine in the DNA complimentary strand.

You might be interested in
Why sometimes, even when we know the danger, we continue to do this matter, for example, you use a sharp tool, You know that it
Soloha48 [4]

Answer:

The fact that you have a task set in mind is something that can make you persist. The urge to satisfy your need to finish that task with the sharp tool is what drives you to persist with using the sharp tool knowing what could be the possible outcome of using it.

Explanation:

7 0
3 years ago
Which city had warmer summers (meteorological summer-June,July,August)?
jarptica [38.1K]
July is the warmest summer it has been proven by me and my fellow class mates.
6 0
3 years ago
A solute uses a protein channel to cross into or out of the cell. What
Natalija [7]
D, active transport because that protein uses atp to cross channels and active transportation is the only form of movement that’s used atp to move
6 0
3 years ago
What are 5 differences between prokaryotic and eukaryotic cells?
e-lub [12.9K]

Answer:

Go to science.org and type your question up, they have plenty of diagrams and i used it to ace all of my bio quizzes.

Explanation:

Hope this helps! Have a great day!

6 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Can people die from the common cold​
    11·2 answers
  • When two experiments are identical except for one variable, the experiment is called a(n) _____.
    15·1 answer
  • What do you think plants need to stay healthy
    14·2 answers
  • Each molecule of table sugar, C12H22O11, contains
    12·1 answer
  • Five importance of Variation​
    11·2 answers
  • Which form of water motion commonly causes natural disasters along shorelines
    13·1 answer
  • How would an increase in nest sites affect a population of pigeons?
    15·1 answer
  • What substance may build up in your body when you follow the Atkins diet? What does this substance do to
    10·1 answer
  • Scenario:
    5·1 answer
  • HELPPP ASAP!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!