Answer:
Smooth and cardiac
Explanation:
Smooth and cardiac muscles are both involuntary.
This means we do not consciously control them. Smooth muscles are found, for example, in the esophagus, and small intestine. The cardiac muscles are found in the heart.
The skeletal muscles are those that we control consciously, such as the muscles for moving our arms and legs.
Answer:
D. Washing your hands before eating.
Explanation:
Option a, b and c are examples of not practicing proper hygiene and they increase the chances of you getting diseases. Option D is the only example that practices proper hygiene.
I think its a because risk actually means exposure to danger our sacrifice your self plz mark as brainly
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
Algae are single celled aquatic plants that need sunlight, food and carbon dioxide in order to thrive. So, the two elements that algae thrives on are nutrients and warm temperatures.
Explanation:
