1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goblinko [34]
3 years ago
7

A basic observation of a star is how bright it appears. This brightness is known as the star's

Biology
2 answers:
Oxana [17]3 years ago
4 0
Star brightness is defined by either <span>D. apparent magnitude - when we measure it from Earth (that is how bright it is from Earth) - this is the closest to "basic observation" and the best answer

or by absolute magnitute - how bright it would be at a certain distance (this allows to compare the brightness).


</span>
AnnyKZ [126]3 years ago
3 0

The right answer is D.

The brightness of the star is measured by the size, which is distinguished in apparent and absolute. The apparent magnitude measures the brightness of the star perceived by the observer; it therefore depends on the real brightness of the star, the distance of the Earth and the atmosphere of the Earth has caused alterations (the view).


The absolute magnitude It is the magnitude that the star would have if it were at the distance of 10 parsecs (or 32.6 light years) from Earth (and it is closely related to the real brightness of the star).

You might be interested in
Human ABO blood type is determined by a single gene that comes in 3 distinct alleles: IA , IB , and i. The IA and IB alleles are
alexandr402 [8]

Answer:

given, mother and father are heterozygotes.

let, father has B blood group and mother has A blood group.

then their heterozygous  genotypes are --

father = iB, iO  and mother = iA, iO

punnett square will be,

        iB        iO

iA     iA iB     iA iO

iO     iB iO    iO iO

the genotypes of their progeny will be, iAiB ,  iAiO ,iBiO and iOiO

and phenotypes will be 3 are heterozygous and 1 is homozygous.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Why out off 500 mouses 237 are black and 263 are white
Black_prince [1.1K]

Answer:

thats not true

Explanation:

makin stuff up... smh

8 0
3 years ago
What sound frequency would a human ear not be able to detect?
CaHeK987 [17]

All of the are false lowest it can be without a human ear picking up is 19 hertz

4 0
3 years ago
Read 2 more answers
What dictates how we assemble amino acids to build proteins, tissue, and organs?
Nina [5.8K]

Answer:

C- DNA

Explanation:

DNA is responsible for protein synthesis.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these elements is found in both carbohydrates and water?
    7·2 answers
  • Please help what is common between the temperate rainforest tropical rainforest and the temperate deciduous forest?
    12·1 answer
  • 1. Five students in your class always sit together in the front row. This could be because (A) they really like each other or (B
    11·2 answers
  • Please help me asap really need help thank you
    6·1 answer
  • If a disease killed all of the frogs in the above food web, which population would be most directly affected in a negative way?
    13·2 answers
  • Which organisms of the Archaea domain live in really salty environments? A. halophiles B. thermophiles C. methanogens
    7·2 answers
  • Causing respiratory rate to
    5·1 answer
  • What is the average recycling rate of the world.
    6·2 answers
  • What form of heat transfer can travel through a vacuum.
    11·1 answer
  • What energy does a microwave use
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!