1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alona [7]
3 years ago
14

How do the retinas of the eyes of night-hunting animals differ from the retinas of animals that hunt during the daytime?

Biology
2 answers:
Alex73 [517]3 years ago
8 0
<span>it would be (a) they have more cell rods. This alows night time animals to receive more light to there eyes seing better were day time animals dont have it.
</span>
Alex17521 [72]3 years ago
5 0
A) They have more cell rods... hope it helps :)
You might be interested in
Cyanobacteria are important to the evolution and advancements of other life on earth because they
kompoz [17]

Answer:

Cyanobacteria are microscopic organisms found in all kinds of water. They are single-celled organisms and produce their own food from sunlight via photosynthesis. Cyanobacteria are important to evolution because they developed the oxygen atmosphere we live in by producing waste from cyanobacteria. Plants also evolved from Cyanobacteria.

3 0
4 years ago
Do rainforests have seasons?  if do What are they?
Serjik [45]
Wet season and dry season ♥️
5 0
4 years ago
Read 2 more answers
Which good container is suitable for transporting food
Zielflug [23.3K]
Plastic tupperware containers
8 0
3 years ago
Artificial selection has been used by humans to
spayn [35]

Answer:

Its been used by humans to take the best traits from a species and pass them on like bigger bodies in cows for more meat and bigger muscles in horses for faster racing potential.

7 0
3 years ago
(Will Upgrade "AGAIN")
Serga [27]
Sound travels faster in solid
4 0
4 years ago
Other questions:
  • Describe ways in which a healthy artery differs from an artery affected by coronary heart disease
    9·1 answer
  • If you wanted to demonstrate a first class lever system to your peers which Childhood toy would you use as a basis for your demo
    5·1 answer
  • You and other scientists have been able to get the same results after many experiments. What is this proven data called?
    8·1 answer
  • The steps of the formation sequence for a terrestrial planet are shown below. what is the correct order of these steps? - accret
    13·1 answer
  • Despite living oceans apart, the North American Kangaroo rat and the Australian hopping
    11·1 answer
  • Which type of succession do the biotic components of a community cause?
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • In general, how do many human activities influence the carbon cycle?
    11·1 answer
  • The graph below shows changes in the populations of two species that interact only with each other over a period of time.
    13·1 answer
  • 2. List and describe two characteristics that distinguish primates from other mammals.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!