1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
2 years ago
10

In the context of cell signaling, to what does the term ligand refer?.

Biology
1 answer:
lubasha [3.4K]2 years ago
7 0
Any small molecule that can bind in a specific manner to a larger one.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The pollen, or sperm, from a red maple tree is unable to fertilize the eggs from a sugar maple tree. this is an example of what
OverLord2011 [107]
Gamete isolation
which of the following lists the level of taxonomic classification in order from the most inclusive to the least inclusive
domain- kingdon- phylum- class- order
8 0
3 years ago
Read 2 more answers
Give brainliest
Kryger [21]

Answer:

Release carbon into the atmosphere through respiration

Explanation:

During cellular respiration the molecule takes in oxygen and glucose. ... Pyruvate is transported into the mitochondria and loses carbon dioxide to form a two-carbon molecule.

5 0
2 years ago
Read 2 more answers
consider the following at 8 p.m. a diabetic is found to have a blood pH of 7.33 is Brian tells his diaphragm to contract more fr
Radda [10]

Answer:

Considering that homeostasis is restored in the patient, his blood pH range would return to normal levels (7.35-7.45), and his hydrogen ion concentration in the blood would normalize. The effect of normalizing the body by getting rid of excess hydrogen ions is achieved by concentrating these ions into the urine for expulsion, therefore increasing the pH levels of urine.

Medical Disclaimer: The information on this site is for academic purposes only and is not a substitute for professional medical advice.

Explanation:

Acidosis is the condition wherein excessive acid build-up within the body causes the blood pH to become lower than normal (normal pH range 7.35-7.45). This may be due to an excessive loss of bicarbonate in the blood, also known as metabolic acidosis, or due to an impairment in the elimination of carbon dioxide in the blood from poor lung function, also known as respiratory acidosis. The body's natural response to acidosis is to increase the breathing rate to eliminate carbon dioxide in the blood, restoring the natural pH of the body.

In people with diabetes mellitus type I, the lack of insulin causes cells to breakdown fat aside from glucose as an energy source. This process produces ketones as a metabolic by-product for energy but also causes the body to be acidic. This is known as diabetic ketoacidosis.

7 0
3 years ago
What is a way a cell is put together called?
Alexus [3.1K]
<span>In table or Excel, it's merging or combining. 
In biology, cells generally don't combine, they split (mother cells splits into two daughter cells)</span>
4 0
3 years ago
Other questions:
  • What are the 2 differences between Plant and animal cells?
    7·2 answers
  • What is the name of the tear drainage channel that extends from the lacrimal sac to the opening in the mucous membrane of the no
    8·1 answer
  • The rain forest canopy has trees of varying heights growing to reach the sunlight. What kind of interaction does this demonstrat
    7·1 answer
  • Arrange the following terms in the correct order: Fertilization, sex cells, meiosis, zygote, mitosis.
    10·1 answer
  • Which statement describes one feature of a mineral's definite chemical composition?
    11·1 answer
  • The toxins (called _______) destroys the material that binds together the layers of the skin.
    10·1 answer
  • I would be very grateful is you can help me!
    11·1 answer
  • EXPLAIN HOW CARBON MOVES
    13·1 answer
  • Help i need this its timed
    11·1 answer
  • 5. Which of the following statements describes processes that occur
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!