1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
2 years ago
12

Which term describes a chemical reaction in which water is gained?

Biology
1 answer:
Temka [501]2 years ago
7 0

Answer:

hydration

Explanation:

cuz water is gained and something is hydrated

You might be interested in
Despite his young age, Ruben was recently diagnosed with hypertension. He knows that reducing dietary sodium and increasing diet
JulijaS [17]

Answer:

Potato

Explanation:

Hypertension is a condition developed due to the continuous high or elevated blood pressure in the arteries in the body. The main cause of hypertension is the contraction of the arteries and the consumption of food with a high level of sodium and low level of potassium.

It is suggested that people with hypertension should consume a diet rich in potassium but with a low amount of sodium.  The good source of food with a high level of potassium is baked potato which provides carbohydrates also, salmon, and the banana.

Since the amount of potassium is high in the baked potato, therefore, is the correct answer.

4 0
3 years ago
Mr. jones has blood type b and mrs. jones has blood type ab. what is the probability that they will have a child with blood type
Tatiana [17]

I think it might be 25% but I'm not sure!

4 0
3 years ago
Read 2 more answers
I'll give brainliest to the person with the correct answer​
Ivan

Answer:

You are correct it's the earth!

Explanation:

The reason why is because, the term "elliptical orbit" is used in astrophysics and astronomy to describe an oval-shaped path of a celestial body. The Earth, as well as all the other planets in the Solar System, follow this type of orbit around the Sun. The shape is created by the varying pull of forces, such as gravity, on two objects, such as the Sun and a planet.

Hope this helps! :)

3 0
2 years ago
Read 2 more answers
Drag each tile to the correct box a woman was chopping vegetables and she accidentally cut her finger a few days later she obser
Illusion [34]
It will be hilled by a week probably
7 0
3 years ago
The cichlid is a colorful fish found in freshwater lakes. There are over a thousand species of cichlid fish today. If a species
Andrej [43]

The idea behind an available niche after extinction leading to speciation is: the fact that those species can grow distinct and then in other to survive develop new traits.

<h3>Meaning of speciation</h3>

Speciation can be defined as a process that births new species with different traits while they evolve.

Speciation occurs when extinction is eminent and most time in other to preserve that race they evolve into something new with new traits.

In conclusion, The idea behind an available niche after extinction leading to speciation is: the fact that those species can grow distinct and then in other to survive develop new traits.

Learn more about Speciation: brainly.com/question/2113835

#SPJ1

5 0
2 years ago
Other questions:
  • Help me on this plz eviromental science
    12·2 answers
  • Plastics remain in the ocean environment because of their stability and resistance to degradation or biological processing. they
    15·1 answer
  • And maximizes:
    5·1 answer
  • At age 85, lyle's immune system does not respond to vaccines as well as it did when he was younger. the atrophy of which endocri
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Please help! Of the skulls below, which one shows the most evidence of upright walking?
    12·2 answers
  • A population of mosquitoes is exposed to the pesticide DDT for several generations. At the end of that time, most individuals in
    9·1 answer
  • Condensation affects weather by
    14·1 answer
  • How many chromosomes are found in a gamete compared to the parental cell?
    15·1 answer
  • as-120 overcomes resistance to atp-competitive fgfr inhibitors in patients with fgfr2 fusion–positive intrahepatic cholangiocarc
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!