1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
2 years ago
9

How does the human immune system initially respond to a pathogen?

Biology
1 answer:
Lapatulllka [165]2 years ago
6 0

Answer:The immune system responds to antigens by producing cells that directly attack the pathogen, or by producing special proteins called antibodies. Antibodies attach to an antigen and attract cells that will engulf and destroy the pathogen.

Explanation:

You might be interested in
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Describe the structure of mitochondria and explain their role in respiration .
oksano4ka [1.4K]
The mitochondria is a double membraned organelle, the inner of these membranes is invaginated to form structures called cristae. The fluid inside is called the mitochondrial matrix. The mitochondria has a pivotal role in the creation of ATP in aerobic cellular respiration. Glycolysis occurs outside the mitochondria, producing pyruvate and ATP, the pyruvate endures the link reaction on its way into the mitochondrial matrix and turns into acetyl co enzyme A. This acetyl group is used in the matrix in what is called Krebs cycle, where the oxidation of acetyl groups is coupled with the reduction of hydrogen carriers. The products of Krebs cycle are then transported to the electron transport chain on the cristae where the reduced NADH and FADH are then oxidized. The remaining hydrogen electrons are transported down the chain where an oxygen molecule is reduced to water. Chemiosmosis also occurs at the electron transport chain, in which hydrogen protons move down the concentration gradient (from the inner mitochondrion membrane) through an ATP synthase where ATP is generated. The multiple folds inside the mitochondria which are the cristae, mean that there is plenty of surface area for cellular respirations to occur at. 
3 0
3 years ago
Read 2 more answers
In some zoos, rare crosses between a male lion and a female tiger have produced hybrid offspring cal are sterile but some female
frez [133]

Answer:

The answer is A

Explanation:

4 0
3 years ago
Read 2 more answers
In modern biology, we currently study how many different kingdoms
zzz [600]
6? I think it has been a while
5 0
3 years ago
Read 2 more answers
What is the primary function of the lymphatic system
aksik [14]
The lymphatic system<span> has multiple interrelated </span>functions<span>: It is responsible for the removal of interstitial fluid from tissues. It absorbs and transports fatty acids and fats as chyle from the digestive </span>system<span>. It transports white blood cells to and from the </span>lymph<span> nodes into the bones.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Why is it unlikely that one gamete would have the “best” traits of both parents
    11·1 answer
  • I don't know how to do any of this someone pls help me with answers
    13·2 answers
  • The alleles for human blood types A and B are co-dominant but both are dominant over the type O allele. The Rh factor is separat
    5·1 answer
  • Which animal kingdom is responsible for asexually reproducing?
    12·2 answers
  • Nucleotides are composed of a sugar, a phosphate group, and a pair of what
    8·1 answer
  • Humans have 46 chromosomes and monkeys have 48 chromosomrs in their cells. Match the cells with the number of chromosomes they c
    8·1 answer
  • Which example describes an abiotic factor interacting with a biotic factor?
    15·1 answer
  • In angiosperms, xylem consists of tracheids and
    5·1 answer
  • Identify the role that cholesterol plays in a human cell.
    8·1 answer
  • What are anthocyanins?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!