1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
2 years ago
10

The genes of the lac operon in E. coli encode enzymes that Multiple choice question. catabolize lactic acid anabolize lactose ca

tabolize glucose catabolize lactose
Biology
1 answer:
Sedaia [141]2 years ago
7 0

The lac operon is encodes multiple enzymes which catabolize lactose, for example beta-galactosidase

<h3>What is an operon?</h3>

An operon is a cluster of genes that are transcribed together to give a single messenger RNA (mRNA) molecule which which is used for the synthesis of multiple proteins.

An example of an operon is lac operon.

The lac operon is encodes multiple enzymes which catabolize lactose, for example beta-galactosidase.

Learn more about lac operon at: brainly.com/question/1695549

You might be interested in
HELP!!! <br><br> Question 3 (2 points)<br> What is the phenotypic ratio of the F2 generation?
Oduvanchick [21]

Answer:

9:7

Explanation:

We get the dominant phenotype in plants that have at least one dominant allele of EACH of the two genes; otherwise, we get the recessive phenotype. So, the observed ratio in the F2 generation is 9:7.

4 0
3 years ago
________ – difficulty in passing current. work is done to pass through ________, releasing energy.
erica [24]
1-Matter and 2-Conduction
6 0
3 years ago
Your biceps muscle is attached with tendons to the top of your humerus and to the end of your radius, near your elbow. What woul
Cerrena [4.2K]

Answer:  the answer is A

i hope this was helpful GOOD LUCK

7 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
describe carbon cycle and explain how the burning of fossil fuels leands on an increase in ocean temperature
zysi [14]

Answer:

When fossil fuels are burned, they release carbon dioxide and other greenhouse gases, which in turn trap heat in our atmosphere, making them the primary contributors to global warming and climate change.

Explanation:

5 0
3 years ago
Other questions:
  • Is it 1, 2,3 or 4th answer
    8·1 answer
  • This question is to guys specifically: Do you find girls who are serious more or less attractive than girls who are extroverted
    15·2 answers
  • Which atom woukd tend to lose one valence electron to another atom to become stable
    15·2 answers
  • Why should organisms that produce more offspring have a more likely chance of survival?
    14·2 answers
  • A species of bird enters a desert environment, and is getting its water by pecking into the stems of cacti. Cacti with which of
    10·1 answer
  • The dimmer star in a two-star system passes in front of the brighter star. Which phenomenon does this describe?
    14·1 answer
  • What must be true if the mesentery is an organ? Choose the three statements that apply.
    14·1 answer
  • HELP When dissolved in water, BLANK
    6·2 answers
  • WILL GIVE BRAINLIST!
    5·2 answers
  • Sensory _____________ respond to stimuli by sending messages to the brain A. Nerve cells, or __________ , are the basic units of
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!