Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
The cells get into your body by the lungs this answer is correct cause i had the same question and my teacher mark it correct
Answer:
%
Explanation:
The ethanol combustion reaction is:
→
If we had the amount (x moles) of ethanol, we would calculate the oxygen moles required:
Dividing the previous equation by x:
We would need 3.30 oxygen moles per ethanol mole.
Then we apply the composition relation between O2 and N2 in the feed air:
Then calculate the oxygen moles number leaving the reactor, considering that 0.85 ethanol moles react and the stoichiometry of the reaction:
Calculate the number of moles of CO2 and water considering the same:
The total number of moles at the reactor output would be:
So, the oxygen mole fraction would be:
%
