1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
4 years ago
11

Do you need consist of nitrogen base pairing. A bonds witn T and C bonds with ( first letter only)

Biology
1 answer:
ivanzaharov [21]4 years ago
4 0
That's guanine...or G.
You might be interested in
What is the role of auxin in plants​
Sophie [7]

Answer:

Auxin is a key regulator of plant growth and development, orchestrating cell division, elongation and differentiation, embryonic development, root and stem tropisms, apical dominance, and transition to flowering

Explanation:

Hope this helps you

3 0
3 years ago
Read 2 more answers
Points give a answer
stiks02 [169]

Answer:idk

Explanation:

6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Describe the substance that make up the planets and their atmospheres
vagabundo [1.1K]
First four are made of rock and rest are made of gases.
Atmospheres of all the planets are made of gases.
6 0
3 years ago
Read 2 more answers
Help Asap. i also need explanations to go with the answer
nlexa [21]

Answer:

D. In an ocean heated by volcanic activity

Explanation:

Most of Earth was covered in water, early organisms weren't evolved enough to walk on land at the time. There are some organisms that feed off of volcanic activity and use it as an energy resource and would adapt to the heat.

<em>"Hot spots create volcanoes on the seafloor. If these volcanoes rise above sea level to become islands, and if they occur in tropical waters, coral reefs will form on them. Since the volcanoes are cones, the reef forms in a circle around the volcano."</em>

<em>-</em><u>https://courses.lumenlearning.com/earthscience/chapter/ocean-organisms/</u>

<em>"Discovered only in 1977, hydrothermal vents are home to dozens of previously unknown species. Huge red-tipped tube worms, ghostly fish, strange shrimp with eyes on their backs and other unique species thrive in these extreme deep ocean ecosystems found near undersea volcanic chains."</em>

<em>-</em>https://ocean.si.edu/ocean-life/invertebrates/hydrothermal-vent-creatures

7 0
3 years ago
Other questions:
  • Sponges have collar cells that trap food and ingest it by proteasespinocytosisphagocytosis or by the enzymes of lysosomes
    13·2 answers
  • A refrigerator requires a. combustion. b. a refrigerant. c. warm air. d. radiation.
    10·2 answers
  • What do we refer to when we separate things into groups based on their common characteristics?
    13·1 answer
  • What is the largest gland in the body?
    10·2 answers
  • What is humidity?
    11·2 answers
  • What are global wind patterns called? La Niña local winds prevailing winds El Niño
    13·2 answers
  • How do planets and stars differ from one another
    8·1 answer
  • 13. Which of these statements about particulate matter less than 2.5 microns in diameter is true?
    13·2 answers
  • I need this answer quick please thanks
    14·2 answers
  • to is when a stimulus successfully stimulates an action potential in its specific neuron. how your brain interprets the message
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!