1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
2 years ago
6

What is H2O? A. Water B. Salt C. Milk D. Carbon Dioxide

Biology
2 answers:
nikdorinn [45]2 years ago
4 0

Answer:

A. Water

Explanation:

H2O stands for or is Water. So, the answer would be A. Water.

I hope it helps! Have a great day!

Pan~

Slav-nsk [51]2 years ago
3 0

Answer:

A.

Explanation:

H2O is water. It has 2 hydrogen atoms and 1 oxygen atom, and that makes H2O which is water.

I hope it helps! Have a great day!

Anygays-

You might be interested in
Electricity is created when ____ move.
Blizzard [7]
Electricity is caused by moving particles that have either a negative or postivite charge
8 0
3 years ago
Read 2 more answers
Each chromosome in this homologous pair possesses a different allele for flower color. Which statement about this homologous pai
Stells [14]

Answer:

These homologous chromosomes represent a maternal and a paternal chromosome

Explanation:

3 0
3 years ago
What occurs during the digestion of proteins?
madreJ [45]

Answer:

Specific enzymes break down proteins into amino acids

7 0
3 years ago
Give an example of the way sexual selection can cause extreme phenotypes in a population
STatiana [176]
<span>When breeding season arrives, male elephant seals define and defend territories. They collect a harem of 40 to 50 females, which are much smaller than their enormous mates. </span>
7 0
3 years ago
!!!!!!!
Anna [14]

Answer:

A.The DNA in the parent cell nucleus makes a copy of itself and is then split between the two daughter cells during meiosis.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • A threadlike structure of dna that carries genes is called
    12·2 answers
  • 1. How does the principle of conservation of mass relate to chemical reactions?
    12·1 answer
  • How does human evolution or natural selection relate to the susceptibility of disease
    8·1 answer
  • Two dangers associated with the exposure of X-ray
    12·1 answer
  • Which features may form as a result of erosion related to runoff?
    7·2 answers
  • In some third world countries "cyanide fishing" for aquarium trade is allowed. Cyanide fishing uses the cyanide to "stun" fish a
    6·2 answers
  • Which has the most immediate effect on the progress of scientific research?
    7·2 answers
  • Is this a good scientific question?
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Why do you think hemoglobin levels vary with altitude?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!