1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
1 year ago
6

Describe and account for the relationship between the two population growth curves between hares and lynx.

Biology
1 answer:
jarptica [38.1K]1 year ago
7 0

Answer:

The lynx's principal food source is the snowshoe hare. These two species' population cycles are intertwined. When hares are abundant, lynx consume almost nothing else and kill two hares every three days. When hares are sparse, lynx eat mice, voles, squirrels, grouse, ptarmigan, and carrion.

You might be interested in
The cell contents, nucleus and cytoplasam, use the oxygen and food while producing the waste. Which two measurements best repres
alex41 [277]
<span>(Volume and Weight).

</span>
3 0
3 years ago
Read 2 more answers
This organ reabsorbs water and electrolytes, and stores feces
Radda [10]

Answer:

A: Esophagus

Explanation:

Hopefully this helps!

8 0
3 years ago
The chemical reaction below represents a metabolic process.
ANEK [815]
Photosynthesis uses carbon and h20 as the reactants
7 0
2 years ago
Why do biologists have to study chemistry?
Snowcat [4.5K]
To understand the phenomenon of biological cell


To understand which principal occurs


To know the whose are reactant and what makes product



Hope for brainliest mark
5 0
2 years ago
What must a substance be able to do in order to be used as an acid base indicator
erastovalidia [21]

The substance must be able to alter its physical characteristic (for example, its color) in accordance to a change in pH. One example of this is litmus paper, which becomes red under acidic conditions and blue under basic conditions.

3 0
3 years ago
Other questions:
  • In terms of genetics, inheritance, and traits what is a “pattern”?
    6·1 answer
  • When a plant cell is placed in salt water, the cell is affected and changes size. What part of the cell will be unaffected?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Choose the list that correctly ranks metabolic rates per gram of body mass, from lowest to highest. view available hint(s) choos
    5·1 answer
  • Nucleic Acid is to heredity as carbohydrate is to
    9·1 answer
  • Which part of the wave has the highest frequency
    11·2 answers
  • Since invasive species did not co-evolve with the other species in the ecosystem where they were introduced _______. a. they can
    7·2 answers
  • What do plants make through the process of photosynthesis
    15·2 answers
  • Different between melting and condenstation​
    7·2 answers
  • Based on information from the periodic table, what does this image<br> represent?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!