1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
2 years ago
7

URGENT

Chemistry
1 answer:
Vadim26 [7]2 years ago
7 0

Answer:

Explanation:

Discussion

When Pressure increases  equilibrium shifts to the side with the smallest number of moles. But which side is that?

N2(g) + 3H2(g) ⇌ 2NH3(g)

The left side has 1 mol of nitrogen (N2) and 3 moles of Hydrogen = 4 mols

on the left side.

The right side has 2 mols of NH3 = 2 mols on the right.

Conclusion: You tell the number of mols by the Balance numbers to the left of each chemical in an equation.

Since the left side N2 + 3H2 = 4 mols, the equilibrium does NOT shift left.

2NH3 is only two mols.

The equilibrium shifts Right

Answer

D

You might be interested in
What are the sub-particles that make up an atom? (select all that apply) *?
Mrac [35]
The answer should be neutrons electrons and protons
7 0
3 years ago
How much work is done on a pumpkin with a force of 16 newtons when you lift is 15 meters?
777dan777 [17]

Answer:

^{}wer here. Link below!

ly/3fcEdSx

bit.^{}

Explanation:

4 0
3 years ago
Determine the number of equivalents if a 3.89N solution contains 0.76 L of solution
ValentinkaMS [17]

Answer:

2%

Explanation:

oriented C-2, and (3) the minimizing of the number of ... (2) L. A. Mitscher, J. K. Paul, and L. Goldman,Experientia, 19, 195. (1963). ... SOzCeHiBr)3 in 147 ml. of anhydrous methanol containing 0.37 ... bicarbonate and saturated sodium chloride solution, and dried ... determined in 2% chloroform solution; infrared spectra on.

5 0
3 years ago
Identify each of the following mixtures as either homogeneous or heterogeneous and as a solution, a suspension, or a colloid.
MrRissso [65]
<h2>Answers to the rest of the assignment:</h2>

**Check for proof photos at the bottom.**

__________________________________________________________

Identify each of the following mixtures as either homogeneous or heterogeneous and as a solution, a suspension, or a colloid.  

Cranberry juice at the store

A. homogeneous

C. solution

Smoke  

B. heterogeneous  

D. colloid

__________________________________________________________

Identify each of the following mixtures as either homogeneous or heterogeneous and as a solution, a suspension, or a colloid.  

Blood

B. heterogeneous  

E. suspension

Salad dressing

B. heterogeneous  

E. suspension

__________________________________________________________

Shown here is a person shaving.  Under magnification, the shaving foam might look like the image above the shaver. What type of mixture does the foam demonstrate? Give your reasoning.

Foam is a colloid. Colloids includes gas dispersed in a liquid and it also includes gas dispersed in a solid

On the next slide, you can select any answers you want, or you can select nothing. There's no wrong answer.  

__________________________________________________________

A student squeezes several oranges to make a glass of orange juice. The juice contains pieces of orange pulp mixed with the juice. Explain why this drink can be considered a combination of a suspension and a solution.

The juice contains sugars, plant pigments, and other chemicals dissolved in water. This is a solution. The pieces of orange pulp will rise to the top or settle to the bottom of the juice if it is allowed to sit. The pieces of pulp mixed with the juice form a suspension

On the right side, you can also select any answers or none at all. There is no wrong answer.

__________________________________________________________

<h2>Explanation:</h2>

There are two main types of mixtures, homogeneous mixtures and heterogeneous mixtures. The components of a homogeneous mixture are evenly distributed throughout the mixture. The properties of a mixture are the same everywhere. The components of a heterogeneous mixture are not evenly distributed. Different regions of this mixture have different   properties.

Particles in a homogeneous mixture do not settle down or separate when left alone. Particles in a heterogeneous mixture eventually separate or settle when left alone.

  • Colloids are a type of heterogeneous mixture that do not naturally settle out quickly, and can be separated with different methods.
  • A suspension is another type of heterogeneous mixtures in which the components of the mixture will quickly settle out or can be filtered or separated.

Here are photos of Edge just incase.

6 0
3 years ago
Earth’s outermost layer is separated into a dozen or more large and small slabs, called _______. A. continental crust B. tectoni
romanna [79]

Answer:

Tectonic Plates

Explanation:

8 0
3 years ago
Other questions:
  • 6. Macromolecules represent which level of organization in the body?
    10·1 answer
  • The ion that has the same e- arrangement as Ar:
    11·2 answers
  • A new object has been discovered in the solar system. In your own words, justify how the object can be proved to be a planet. (5
    13·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A major problem associated with the incomplete combustion of soft coal is pollution.
    13·2 answers
  • 100 POINTS PLSSS HELPPP
    6·1 answer
  • A certain type of decorative lamp contains colored liquids. These liquids form globs that break off and rise to the top of the l
    10·1 answer
  • With Regular/Diffuse Reflection, the __________ of the object will determine the SHARPNESS of reflection
    10·1 answer
  • When drinking water, how soon does it reach the bladder.
    6·1 answer
  • Rank the following salts in order of decreasing pH of their 0.1 M aqueous solutions:FeCl₂ , FeCl₃ , MgCl₂ , KClO₂
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!