1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anettt [7]
1 year ago
5

Darwin spent five years collecting information while on a voyage aboard the ____________

Biology
1 answer:
LUCKY_DIMON [66]1 year ago
5 0
HMS Beagle is the name of the ship
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
In a cross aabbcc x aabbcc, what is the probability of producing the genotype aabbcc?.
Anni [7]

Answer:

1/8

Explanation:

Traditional method of solving this problem can be by using the punnett square.

3 0
2 years ago
Hloroplasts are energy organelles found in _____. animal cells plant and animal cells all living cells plant cells
enot [183]

I am going to assume you meant "chloroplasts" instead of "Hloroplasts"

Your answer will be plant cells

Chloroplasts makes the energy for the plant by conducting photosynthesis, therefore, they are only found in plant cells.

4 0
3 years ago
Which feature of junipers makes them good at preventing soil erosion?
Ber [7]

The correct answer is (D)

Junipers belongs to genus Juniperus and are coniferous plants. These plants are widely distributed in northern hemisphere, from Arctic, south to tropical Africa and from Ziarat to Tibet, and in mountains of central America.

Juniper is a shrubs and grow densely over an area, shrubs are a great way to deter foot traffic through an area( another contributor to soil erosion). It helps to prevent soil erosion and are easy to grow plants.

5 0
3 years ago
Read 2 more answers
The fetal skeletal is made of cartilage and eventually turns to bone in a process called ossification. Given what you know about
RoseWind [281]

Answer:

Explanation:

Based on what is known about the fetal skeleton and the ossification process it can be said that this occurs due to babies having more of the osteoblasts bone cells. These cell's main function is to lay down new bone material, this therefore creates a thicker harder bone which allows for proper support so that the body can continue growing and become stronger overall.

4 0
3 years ago
Other questions:
  • In embryo development stage 2, what type of replication are the first cells undergoing? what do you think would happen if a muta
    12·1 answer
  • How many hydrogen bonds can a single water molecule form
    15·1 answer
  • Write down your ideas for how the ability to communicate using low-frequency sounds may provide an adaptive advantage for surviv
    12·1 answer
  • True or False: <br><br> The first step in glycogen synthesis is the phosphorylation of glucose.
    9·1 answer
  • Contracts Slowly Striated Voluntary
    14·1 answer
  • How many genotypes are possible for the offspring
    6·2 answers
  • what are your bones made up of? please list them all! (if you answer correctly, i will mark branliest!)
    5·1 answer
  • Describe what causes convection currents, and how they result in the movement of tectonic plates. The best answer gets brainlies
    13·1 answer
  • 2. What source of energy do organisms use if they don't use the sun's energy?
    12·1 answer
  • Allosteric inhibition is when a chemical
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!