1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
2 years ago
7

What two properties affect the density of ocean water?

Chemistry
1 answer:
mihalych1998 [28]2 years ago
5 0

Answer: temperature and salinity.

Explanation:

You might be interested in
Atomic bombs are a type of nuclear weapon. List three reasons people might be fascinated by something as dangerous as a nuclear
Evgesh-ka [11]

I'm fascinated with them myself,lol. Anything dangerous really.

1.They have the power to destroy the world.

2.They can wipe out your enemies.

3.If you are crazy enough to use one of these, your enemies will know not to mess with you

6 0
3 years ago
Read 2 more answers
A sample of iodine is easiest to ship as a powder because it is making it easy to break into small pieces.What goes in the blank
Gemiola [76]
The answer is brittle 
7 0
3 years ago
Read 2 more answers
ANSWER ASAPP<br> What causes the motion of particles? And more energy equals what?
STALIN [3.7K]

Answer:

particles in solids are always vibrating (moving back and forth) in place the vibrational motion of particles in solids is kinetic energy heat makes the particles in a solid vibrate faster, giving them more kinetic energy faster-vibrating particles bump into one another more often and hit each other harder

4 0
3 years ago
Elemnt name, atomic number, atomic mass, protons, neutrons, elsctrons 1-10
Anika [276]
<h2><em>Answer:</em></h2><h2><em>Hydrogen </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 1 </em></h2><h2><em> </em></h2><h2><em>Symbol: H </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 1 </em></h2><h2><em> </em></h2><h2><em>Protons: 1 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 0 </em></h2><h2><em> </em></h2><h2><em>Electrons: 1 </em></h2><h2><em> </em></h2><h2><em>Helium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 2 </em></h2><h2><em> </em></h2><h2><em>Symbol: He </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 4 </em></h2><h2><em> </em></h2><h2><em>Protons: 2 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 2 </em></h2><h2><em> </em></h2><h2><em>Electrons: 2 </em></h2><h2><em> </em></h2><h2><em>Lithium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 3 </em></h2><h2><em> </em></h2><h2><em>Symbol: Li </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 7 </em></h2><h2><em> </em></h2><h2><em>Protons: 3 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 4 </em></h2><h2><em> </em></h2><h2><em>Electrons: 3 </em></h2><h2><em> </em></h2><h2><em>Beryllium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 4 </em></h2><h2><em> </em></h2><h2><em>Symbol: Be </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 9 </em></h2><h2><em> </em></h2><h2><em>Protons: 4 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 5 </em></h2><h2><em> </em></h2><h2><em>Electrons: 4 </em></h2><h2><em> </em></h2><h2><em>Boron </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 5 </em></h2><h2><em> </em></h2><h2><em>Symbol: B </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 11 </em></h2><h2><em> </em></h2><h2><em>Protons: 5 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 6 </em></h2><h2><em> </em></h2><h2><em>Electrons: 5 </em></h2><h2><em> </em></h2><h2><em>Carbon </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 6 </em></h2><h2><em> </em></h2><h2><em>Symbol: C </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 12 </em></h2><h2><em> </em></h2><h2><em>Protons: 6 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 6 </em></h2><h2><em> </em></h2><h2><em>Electrons: 6 </em></h2><h2><em> </em></h2><h2><em>Nitrogen </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 7 </em></h2><h2><em> </em></h2><h2><em>Symbol: N </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 14 </em></h2><h2><em> </em></h2><h2><em>Protons: 7 </em></h2><h2><em> </em></h2><h2><em>Neutrons:7 </em></h2><h2><em> </em></h2><h2><em>Electrons: 7 </em></h2><h2><em> </em></h2><h2><em>Oxygen </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 8 </em></h2><h2><em> </em></h2><h2><em>Symbol: O </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 16 </em></h2><h2><em> </em></h2><h2><em>Protons: 8 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 8 </em></h2><h2><em> </em></h2><h2><em>Electrons: 8 </em></h2><h2><em> </em></h2><h2><em>Fluorine </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 9 </em></h2><h2><em> </em></h2><h2><em>Symbol: F </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 19 </em></h2><h2><em> </em></h2><h2><em>Protons: 9 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 10 </em></h2><h2><em> </em></h2><h2><em>Electrons: 9 </em></h2><h2><em> </em></h2><h2><em>Neon </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 10 </em></h2><h2><em> </em></h2><h2><em>Symbol: Ne </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 20 </em></h2><h2><em> </em></h2><h2><em>Protons: 10 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 10 </em></h2><h2><em> </em></h2><h2><em>Electrons: 10 </em></h2><h2><em> </em></h2><h2><em>Sodium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 11 </em></h2><h2><em> </em></h2><h2><em>Symbol: Na </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 23 </em></h2><h2><em> </em></h2><h2><em>Protons: 11 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 12 </em></h2><h2><em> </em></h2><h2><em>Electrons: 11 </em></h2><h2><em> </em></h2><h2><em>Magnesium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 12 </em></h2><h2><em> </em></h2><h2><em>Symbol: Mg </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 24 </em></h2><h2><em> </em></h2><h2><em>Protons: 12 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 12 </em></h2><h2><em> </em></h2><h2><em>Electrons: 12 </em></h2><h2><em> </em></h2><h2><em>Aluminum </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 13 </em></h2><h2><em> </em></h2><h2><em>Symbol: Al </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 27 </em></h2><h2><em> </em></h2><h2><em>Protons: 13 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 14 </em></h2><h2><em> </em></h2><h2><em>Electrons: 13 </em></h2><h2><em> </em></h2><h2><em>Silicon </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 14 </em></h2><h2><em> </em></h2><h2><em>Symbol: Si </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 28 </em></h2><h2><em> </em></h2><h2><em>Protons: 14 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 14 </em></h2><h2><em> </em></h2><h2><em>Electrons: 14 </em></h2><h2><em> </em></h2><h2><em>Phosphorus </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 15 </em></h2><h2><em> </em></h2><h2><em>Symbol: P </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 31 </em></h2><h2><em> </em></h2><h2><em>Protons: 15 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 16 </em></h2><h2><em> </em></h2><h2><em>Electrons: 15 </em></h2><h2><em> </em></h2><h2><em>Sulfur </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 16 </em></h2><h2><em> </em></h2><h2><em>Symbol: S </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 32 </em></h2><h2><em> </em></h2><h2><em>Protons: 16 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 16 </em></h2><h2><em> </em></h2><h2><em>Electrons: 16 </em></h2><h2><em> </em></h2><h2><em>Chlorine </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 17 </em></h2><h2><em> </em></h2><h2><em>Symbol: Cl </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 35 </em></h2><h2><em> </em></h2><h2><em>Protons: 17 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 18 </em></h2><h2><em> </em></h2><h2><em>Electrons: 17 </em></h2><h2><em> </em></h2><h2><em>Argon </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 18 </em></h2><h2><em> </em></h2><h2><em>Symbol: Ar </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 40 </em></h2><h2><em> </em></h2><h2><em>Protons: 18 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 22 </em></h2><h2><em> </em></h2><h2><em>Electrons: 18 </em></h2><h2><em> </em></h2><h2><em>Potassium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 19 </em></h2><h2><em> </em></h2><h2><em>Symbol: K </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 39 </em></h2><h2><em> </em></h2><h2><em>Protons: 19 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 20 </em></h2><h2><em> </em></h2><h2><em>Electrons: 19 </em></h2><h2><em> </em></h2><h2><em>Calcium </em></h2><h2><em> </em></h2><h2><em>Atomic Number: 20 </em></h2><h2><em> </em></h2><h2><em>Symbol: Ca </em></h2><h2><em> </em></h2><h2><em>Atomic Mass: 40 </em></h2><h2><em> </em></h2><h2><em>Protons: 20 </em></h2><h2><em> </em></h2><h2><em>Neutrons: 20 </em></h2><h2><em> </em></h2><h2><em>Electrons: 20</em> </h2>

4 0
3 years ago
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
Other questions:
  • An atom had an average atomic mass of about 63.5 amu. What is the chemical symbol for the atom?
    14·1 answer
  • What is conditional reflexes?? ​
    5·1 answer
  • What is the average speed vavg of the molecules in the gas? express your answer numerically to three significant digits?
    6·1 answer
  • Which is the first element in the periodic table to have an electron configuration in the 4th energy level? beryllium carbon pot
    12·2 answers
  • Which statement describes the bood type of a person with the alleles /A/B​
    12·1 answer
  • 1. What is the main difference between a nuclear power plant and a coal burning power plant?
    7·1 answer
  • Which of the following are state functions?: Temperature, Enthalpy, Exergy, Internal Energy, Adiabatic Work, Heat (2 marks) b) P
    6·2 answers
  • Have more points because i dont care
    14·2 answers
  • A 25°C sample of gas has a volume of 5.0 L. What will it’s volume be if it is heated to 50.0°C?
    8·1 answer
  • Please help Please Help
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!