1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
1 year ago
13

Population projections estimate that by 2050 we will reach a world population of 11 billion. the world already faces issues feed

ing the 7 billion people that currently live here. should genetically modified organisms be used to help meet the world’s food needs?
Biology
1 answer:
MatroZZZ [7]1 year ago
8 0

Yes, Genetically Modified Organisms (GMOs) should be used to help meet the world’s food needs but with taking care of all the ethical concerns.

<h3>What are genetically modified organisms</h3>

Organisms whose genetic material i.e. genes are being modified by certain molecular biology techniques are known as genetically modified organisms. The genes which are manipulated or modified are known as transgenes therefore these organisms are also known as transgenic organisms.

<h3>Why should they be used to help meet the world’s food needs?</h3>

As the world’s population is rapidly increasing, there is a need for new technologies which can help meet this challenge. Currently, the agriculture which is practiced today is not sustainable, a lot of herbicides and pesticides are being used which has led to massive destruction of the lands.

So, genetically modified organisms become a solution to it.

To know more about genetically modified organisms visit:

brainly.com/question/27310003

#SPJ4

You might be interested in
Which describes John datiton observations of elements in any given compound
dmitriy555 [2]

Atoms of different elements always combine in the same way.

John Dalton noted that if the components are added to one exacerbated, the share of their masses will dependably be the same. Dalton's been an English scholar. The component mass of that mix is measured by the confirmation of the presence of molecules assembled by John Dalton.

3 0
3 years ago
What are some examples of bodily functions that require ATP (Active Transport) to move molecules in and out of cells?
Firdavs [7]
Cellular Respiration
4 0
3 years ago
The parts of DNA that provides the code for proteins are
PIT_PIT [208]

Answer:

The genome of an organism is inscribed in DNA, or in some viruses RNA. The portion of the genome that codes for a protein or an RNA is referred to as a gene. Those genes that code for proteins are composed of tri-nucleotide units called codons, each coding for a single amino acid.

Explanation:

5 0
3 years ago
What are two basic differences between DNA and RNA? RNA is usually single stranded, while DNA is usually double stranded. RNA co
aivan3 [116]

Answer:

Explanation

the two basic difference between RNA and DNA are

RNA is single stranded while DNA is double stranded

RNA contain uracil and DNA contain thymine

4 0
3 years ago
Read 2 more answers
How do you get the energy you need for life activities
Olenka [21]

Answer:

I think this would help you Sun, water, food, animals, etc.

5 0
3 years ago
Other questions:
  • Sara and juan conducted an experiment to test which soil would be best for growing plants. they planted bean seeds in four pots
    12·2 answers
  • Which kind of organism is an autotroph? consumer producer decomposer herbivore
    10·2 answers
  • Semen is a combination of A) fluid from the seminal glands and bulbo-urethral glands B) fluid from the prostate and sperm C) sem
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What effect does the Continental Divide have on the direction of river flow in the United States? Hint: Read Topic ” Which direc
    6·2 answers
  • Match each description with the correct ecosystem.
    11·2 answers
  • I give out brainlist
    13·1 answer
  • PLS HELP ME WITH THIS ASAP
    11·2 answers
  • Which form of water is not considered as a resource? A) groundwater B) glacial ice C) ocean water D) water vapor E) surface wate
    9·1 answer
  • Which of the following types of interactions is an example of a symbiotic relationship?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!