1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveticcg [70]
2 years ago
11

Write the empirical formula for at least four ionic compounds that could be formed from the following ions:

Chemistry
1 answer:
CaHeK987 [17]2 years ago
5 0

Answer:

Fe(CN)₂,  FeCO₃,  Pb(CN)₄,  Pb(CO₃)₂

Explanation:

Cations (positively charged ions) can only form ionic bonds with anions (negatively charged ions). However, you can't just simply put one cation and one anion together to form a compound. Each compound needs to been neutral, or have an overall charge of 0. When cations and anions do not have charges that perfectly cancel, you need to modify the amount of each ion in the compound.

1.) Fe(CN)₂
-----> Fe²⁺ and CN⁻

-----> +2 + (-1) + (-1) = 0

2.) FeCO₃

-----> Fe²⁺ and CO₃²⁻

-----> +2 + (-2) = 0

3.)  Pb(CN)₄

-----> Pb⁴⁺ and CN⁻

-----> +4 + (-1) + (-1) + (-1) + (-1) = 0

4.) Pb(CO₃)₂

-----> Pb⁴⁺ and CO₃²⁻

-----> +4 +(-2) + (-2) = 0

You might be interested in
Purification of nickel can be achieved by electrorefining nickel from an impure nickel anode onto a pure nickel cathode in an el
Alexxandr [17]

Answer: 530 hours

Explanation:

The reduction of Nickel ions to nickel is shown as:

Ni^{2+}+2e^-\rightarrow Ni

96500\times 2=193000Coloumb of electricity deposits 1 mole of Nickel

1 mole of Nickel weighs = 58.7 g

Given quantity = 18.0 kg = 18000 g  (1kg=1000g)

58.7 g of Nickel is deposited by 193000 C of electricity

18000 g of Nickel is deposited by = \frac{193000}{58.7}\times 18000=59182282.8C of electricity

Q=I\times t

where Q= quantity of electricity in coloumbs  = 59182282.8C

I = current in amperes = 31.0 A

t= time in seconds = ?

59182282.8C=31.0A\times t

t=1909105.9sec

(1h=3600 sec)

t=530hours

Thus 530 hours are required to plate 18.0 kg of nickel onto the cathode if the current passed through the cell is held constant at 31.0 A

3 0
3 years ago
What is the ph of a peach with a [ –oh] = 3.2 × 10 –11 m?
3241004551 [841]

Answer:

Amerigo Vespucci, was the first European to reach the Caribbean Islands.

Please select the best answer from the choices provided

T

F

Explanation:

7 0
2 years ago
The compound Fe₂O3contains how many atoms?<br> 2<br> 3<br> 5<br> 7
BaLLatris [955]

Answer:

5

Explanation:

in this compound:

Fe has 2 atoms

oxygen has 3 atoms

4 0
2 years ago
One way of obtaining pure sodium carbonate is through the decomposition of the mineral trona, Na3(CO3)(HCO3)·2H2O. 2Na3(CO3)(HCO
zhenek [66]
Percentage yield = (actual yield / theoretical yield) x 100%

The balanced equation for the decomposition is,
 2Na₃(CO₃)(HCO₃)·2H₂O(s) → 3Na₂CO₃(s) + CO₂(g) + 5H₂<span>O(g)

The stoichiometric ratio between </span>Na₃(CO₃)(HCO₃)·2H₂O(s)  and Na₂CO₃(s) is 2 : 3

The decomposed mass of Na₃(CO₃)(HCO₃)·2H₂O(s) = 1000 kg
                                                                                     = 1000 x 10³ g

Molar mass of Na₃(CO₃)(HCO₃)·2H₂O(s) = 226 g mol⁻¹
moles of Na₃(CO₃)(HCO₃)·2H₂O(s) = mass / molar mass
                                                         = 1000 x 10³ g / 226 g mol⁻¹
                                                         = 4424.78 mol

Hence, moles of Na₂CO₃ formed = 4424.78 mol x \frac{3}{2}
                                                     = 6637.17 mol

Molar mass of Na₂CO₃ = 106 g mol⁻¹

Hence, mass of Na₂CO₃ = 6637.17 mol x 106 g mol⁻¹
                                        = 703540.02 g
                                        = 703.540 kg

Hence, the theoretical yield of Na₂CO₃ =  703.540 kg
Actual yield of Na₂CO₃ = 650 kg

Percentage yield = (650 kg / 703.540 kg) x 100%
                            = 92.34%
7 0
3 years ago
What is the electronic structure of carbon
horsena [70]

Answer:

[He] 2s2 2p2

Explanation:

5 0
4 years ago
Other questions:
  • A better picture of the crossword
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • The process of burning means to react a substance with <br><br> is oxygen
    11·1 answer
  • What type of chemical process is used to create perfume?
    11·1 answer
  • Help me answer Number 8 please
    12·1 answer
  • A certain first-order reaction (A→products) has a rate constant of 8.10×10−3 s−1 at 45 ∘C. How many minutes does it take for the
    12·1 answer
  • Which of the following is not a reason to use an alloy instead of a pure metal?
    14·2 answers
  • No longer need to be answered.
    12·1 answer
  • 0.20 g of sodium hydroxide (NaOH) pellets are dissolved in water to make 4.5 L of solution. What is the pH of this solution?
    8·1 answer
  • Which of the following is similar in size to an atom?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!