1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dusya [7]
1 year ago
8

Proteins, nucleic acids, and carbohydrates are grouped by common structural features found within their group. lipids can be gro

uped based on:______.
Biology
1 answer:
PIT_PIT [208]1 year ago
6 0

Proteins, nucleic acids, and carbohydrates are grouped by common structural features found within their group. lipids can be grouped based on their high solubility in nonpolar solvents, and their preponderance of nonpolar groups.

Non-polar solvents cannot dissolve a polar compounds since no opposite charge exist, and the polar compound is not attracted. It is this becuase of absence of partial charge that also makes these molecules non-polar. Some of examples of non-polar solvents include benzene, hexane, pentane, toluene, etc.

Higher the solubility of a compound is that the larger the amount of the compound which can dissolve in a solution.

Learn more about nonpolar solvents here

brainly.com/question/14129775

#SPJ4

You might be interested in
When blood glucose levels rise above the normal range, the pancreas secretes ________, but when blood glucose levels fall below
stich3 [128]
Glucose level increase, insulin is secreted.

glucose level decrease, glucagon is secreted
8 0
3 years ago
In living organisms, lipids are used for
tatiyna
The Answer is Quick energy.
4 0
3 years ago
Una historia de la cual se envidencian los aspectos ambientales
morpeh [17]

The study of human interaction with the natural world over time is environmental history, emphasizing the active role that nature plays in influencing human affairs and vice versa. ... The first, nature itself and its change over time, includes human physical impact on the land, water, atmosphere, and biosphere of the Earth.

6 0
2 years ago
How can two species share the same habitat without driving the other to extinction?
Scrat [10]
It is not possible for two species with the same niche to coexist. one species will eventually drive the other into extinction

6 0
3 years ago
Its Multiple Answers!!!
viva [34]
The answer to this is C.
8 0
2 years ago
Read 2 more answers
Other questions:
  • A researcher collected archaea and protists from a thermal vent. how do the cells of these two organisms differ?
    5·1 answer
  • Which type of monkeys do humans resemble? Explain.
    8·2 answers
  • Atp serves as a common energy source for organisms because
    9·1 answer
  • An 18-year-old adolescent who was diagnosed with new-onset type 1 diabetes mellitus has stress and reports not having a menstrua
    14·1 answer
  • GAS is an acronym for ________.Select one: a. general adaptation syndrome. b. general acceleration due to stress. c. growth adju
    15·1 answer
  • Which molecule is most common in the human body? A.N2 B.CO2 C.H2O D.H2
    8·1 answer
  • How long does a octopus live.
    6·2 answers
  • Which units represent density? Select all that apply.
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Example of FAST moving carbon.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!