1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Strike441 [17]
9 months ago
12

The dna content for an organism is analyzed. The results showed that 21% of the nucleotides contained the nitrogenous base adeni

ne. What else can be inferred based on this data? select all that apply.
Biology
1 answer:
Serjik [45]9 months ago
4 0

If the results show that 21% of the nucleotides contain adenine, then the cytosine fraction in vivo is 29% and the thymine fraction is also 21% (options A and C).

<h3>Define double helix model of DNA?</h3>
  1. DNA is a double helix molecule made up of two long strands of nucleotides.
  2. There are four types of nucleotides in DNA, each containing a different nitrogenous base: adenine, guanine, thymine, cytosine.
  3. Adenine always pairs with thymine and guanine pairs with cytosine, according to the base-pairing rules.
  4. As a result, the percentage of adenine equals the percentage of thymine, and the remaining percentage equals guanine + cytosine (29 + 29 = 58 >> 58 + 21 + 21 = 100).
  5. Therefore, if the results show that 21% of the nucleotides contain adenine, then the percentage of cytosine in vivo is 29% and the percentage of thymine is also 21%

To know more about double helix model of DNA, visit:

brainly.com/question/3789581

#SPJ4

The complete question is as follows:

The DNA content for an organism is analyzed. The results showed that 21% of the nucleotides contained the nitrogenous base adenine. What else can be inferred based on this data? Select all that apply

A) The percentage of cytosine is 29%.

B) The percentage of adenine is 21% for all organisms.

C) The percentage of thymine in the organism is also 21%.

D) The percentage of guanine in the organism is also 21%.

E) The percentage for cytosine in the organism is also 21%.

You might be interested in
Why is it important for scientists to avoid having bias? A. So they make objective observations B. So they get more funding C. S
uysha [10]
So they make objective observations
5 0
3 years ago
Suppose the universe were completely empt except for one object a solid sphere moving through space at a speed of 100 lms what s
babunello [35]

Answer:

Straight line path.

Explanation:

Speed is the rate at which an object covers a particular distance. According to the question, the object was moving with constant speed, there is no change in the direction as well, This imply that the object is moving with constant velocity.  No external forces applied on the object. Therefore the object is moving on a straight line path.

7 0
3 years ago
Read 2 more answers
Factors<br> Increase or Decrease<br> in Carrying Capacity?
ale4655 [162]

Answer:

Carrying capacity, or the greatest number of people that an environment can support over time without harming or degrading it, is controlled by a few basic factors: food supply, water availability, and space. Carrying capacity, or the greatest number of people that an environment can support over time without harming or degrading it, is controlled by a few basic factors: food supply, water availability, and space.

Explanation:

5 0
2 years ago
Which statements about what happens in glyclosis are true? select all the apply.
12345 [234]

Answer:

a and b c

Explanation:

3 0
2 years ago
The diagram shows a food web.What is most likely to happen if the snake population is wiped out?
BlackZzzverrR [31]
I say The answer is C
7 0
2 years ago
Other questions:
  • How are chlorophyll and chloroplasts related, and where are they found?
    8·1 answer
  • Climate distribution of earth is primarily controlled by:
    14·1 answer
  • Which of these experiments with make use of qualitative data?
    10·1 answer
  • Mitochondria can be described as
    9·1 answer
  • What is representative organism? <br> Please need help now!!!!!!!!!!!!!!!!!!!!!!1
    15·1 answer
  • In certain Native American groups, albinism due to a homozygous recessive condition in the biochemical pathway for melanin is so
    11·1 answer
  • State what scientists might do to successfully combat bacteria that are resistant to vancomycin​
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the function of dna ligase .
    12·1 answer
  • Please help me I’m so confused
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!