1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Savatey [412]
1 year ago
6

which example of a missense mutation in a protein-encoding gene would most likely be a neutral mutation?

Biology
1 answer:
KATRIN_1 [288]1 year ago
3 0

An example of a missense mutation in a protein-encoding gene would most likely be a neutral mutation is option B: replacement of a polar amino acid with another polar amino acid at the protein's surface.

A frequent and well-known example of a missense mutation is the blood condition sickle-cell anemia. Missense mutations exist in the DNA at a single location in sickle-cell anemia patients. A different amino acid is required in this missense mutation, which also alters the overall structure of the protein. Similarly, replacement of a polar amino acid by another polar Ami no acid at the protein's surface is a missense mutation causing change in a single site.

A neutral mutation is one whose fixation is unrelated to natural selection. Therefore, the independence of a mutation's fixation from natural selection can be used to define the selective neutrality of a mutation.

To know more about mutations, refer to the following link:

brainly.com/question/20407521

#SPJ4

Complete question is:

Which example of a missense mutation in a protein-encoding gene would most likely be a neutral mutation?

a) Replacement of a polar amino acid with a nonpolar amino acid at the protein's outer surface

b) Replacement of a polar amino acid with another polar amino acid at the protein's surface

c) Replacement of a polar amino acid with another polar amino acid in the protein's interior

d) Replacement of a polar amino acid with a nonpolar amino acid in the protein's interior

You might be interested in
What is your defenition of the word biochemistry
Vlada [557]

the branch of science concerned with the chemical and physicochemical processes and substances that occur within living organisms.

7 0
3 years ago
Which of the following statements most accurately describes how water moves through the earth and its atmosphere
gtnhenbr [62]
Evpor in water it's became rain clouds it was moving place to place
6 0
3 years ago
When the moon is on the same side of the earth as the sun we will see a ___ moon
torisob [31]

Answer:

A new moon.

Also results in "blood" or harvest moon.

Hope it helps!

5 0
3 years ago
Read 2 more answers
A student measures the air pressure inside her bicycle tires before and after she goes on
jeka57 [31]

Answer:

Explanation:

123

4 0
3 years ago
What is the “fluid-filled sac” that cushions the embryo?
MAVERICK [17]
The answer is A. Amniotic sac
5 0
3 years ago
Read 2 more answers
Other questions:
  • Select all that apply. Nucleic acids _____. are the largest of the four main biological macromolecules determine whether an orga
    6·2 answers
  • Which pair of body systems provide the raw materials that cells need for energy?
    7·2 answers
  • How is sexual reproduction different from asexual reproduction??
    5·1 answer
  • in a backyard in Georgia you may observe trees shrubs grass pets and birds lizards worms honeybees and many other living organis
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 21. What does “opt out” mean with regards to Europe’s organ donation policy?
    7·2 answers
  • Please help! Will pick brainist!
    6·1 answer
  • ESS3-1 Mesopotamia used continuous irrigation to get water to their crops. Egypt constructed basins that
    12·2 answers
  • Development refers to the increase in size of an individual<br><br> true <br> false
    9·2 answers
  • What is the typical sign that appears in the early ambulatory stage of Duchenne Muscular Dystrophy
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!