1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
14

Skin cancer is to exposure to uv radiation as

Biology
1 answer:
Nikolay [14]3 years ago
4 0
Acne is to excessive secretion of oil
You might be interested in
What happens when heat from inside Earth is transferred to its surface?
Studentka2010 [4]

Explanation:

B. MORE DENCE MATERIAL IS PUSHED TO THE CRUST

6 0
2 years ago
What are three ways that absolute dating can be used in the real world?
Alex_Xolod [135]
Answer:
first everyone needs time leave the house
Explanation: then see other people get time know more people then FUND TGE ONREEEE
4 0
2 years ago
What organelles help the nucleus do its job?
shepuryov [24]
Endoplasmic Reticulum. -- Transport System. Golgi Apparatus -- Delivery System. Lysosomes - Intracellular Digestion Centers. Ribosomes - Sites of Protein Synthesis. ENERGY RELATED ORGANELLES. Cytoskeleton - Support System. Related to Movement.
6 0
3 years ago
What molecule acts as an electron acceptor in glycolysis.
Vitek1552 [10]

Answer:

NADH

Explanation:

4 0
2 years ago
Which features would you expect to find along Boundary A?
makvit [3.9K]
2- Fault Lines (California is a big clue my homie)
7 0
3 years ago
Other questions:
  • (d) Referring to Figure 1B, explain why any newly synthesized strand of DNA is the result of both continuous and discontinuous D
    14·1 answer
  • A student uses a microscope to observe a single-celled organism that can move. The organism contains a nucleus and many chloropl
    5·1 answer
  • Dr. hersh treats her bipolar patients with lithium, a silvery-white mineral, as well as other _____ drugs.
    14·1 answer
  • What is ecology?<br>what are the levels of biological organization from smallest to largest?​
    13·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the four carbon reservoirs receives most of the carbon industrial combustion, or the burning of fossil fuels?
    13·1 answer
  • Language serves ___________ functions when it helps you define yourself and your membership in larger groups.
    5·1 answer
  • The mutation of a cell for a specific function is called
    10·2 answers
  • What is the difference between a mass extinction and a regular (background) extinction? (1 point)
    14·1 answer
  • The motor neuron and all the myofibers it innervates is referred to as a ____________ . every time a motor neuron sends a nerve
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!