1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
5

Bison are grazers, living in herds that migrate in search of better pasture. Bison live in _____. deserts grasslands freshwater

biomes tropical rain forests
Biology
2 answers:
Vsevolod [243]3 years ago
4 0
Bison are gazers. They live in herds and they migrate in search of better pastures. Bisons live in the grasslands. The grassland biome is when the <span>lands are dominated by grasses as opposed to trees and shrubs.</span>
Nady [450]3 years ago
3 0

Answer: Bison live in the grassland.

Explanation: I just heard someone talking about in class the other day, plus I saw in Animal Discovery.

You might be interested in
Which area of the world is included in Oceania?
klemol [59]

Hawaii is included in Oceania

Explanation:

Hawaii is the constituent state of USA. It became the 50th US state on 21 August 1959.  It is famous for volcanic island. Honolulu is capital of Hawaii. The Honolulu is on the Oahu island. Hawaii island lie 2397 miles from San Francisco, California. It is economically vigorous state.

Mauna Loa and Mauna Kea are the highest mountains of Hawaii island. Niihau, Lanai, Kahoolawe, Molokai, Maui, Kauai, Oahu, and Hawaii are eight major island which is eastern end of chain

4 0
3 years ago
What is true of renewable resources? A) They may be used up if consumption continues at its current rate. B) They are only found
igor_vitrenko [27]

C) because solar, wind, hydro, geothermal, biomass, ocean are all was thaer

4 0
3 years ago
Read 2 more answers
The nurse asks a patient to say "ahh" while performing suctioning. what is the rationale behind this intervention?
ivanzaharov [21]
To assist in opening the glottis
4 0
3 years ago
Read 2 more answers
Match the following <br><br> (Will mark brainliest)
attashe74 [19]

Answer:

Maple seed with toma

Explanation:

6 0
3 years ago
PLEASE HELP
Doss [256]

Explanation:

I'm not an expert or sum, but with using logic I would choose: DNA plays a role in the growth and reproduction of organisms, DNA guides the formation of an organism's structures.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Similarities and differences between fungi and plants?
    14·1 answer
  • The very rigorous medical program at a local university has a 10% drop out rate for each year. if the school admits 1,000 freshm
    14·1 answer
  • What is a system of channels, pipes, and tunnels that carries water a long distance?
    15·1 answer
  • MOST DIFFICULT QUESTION OF ALL TIME. CAN YOU SOLVE?????????????????????????????????????????????? ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    9·2 answers
  • What are 5 major environmental challenges?
    9·1 answer
  • Order the steps for vaccination
    9·1 answer
  • Suppose you wanted to determine whether you had adequately sampled the species richness of a given amphibian community. Which re
    13·1 answer
  • As natural selection influences a population, the population becomes
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 19. Which of the following is the best strategy to control wheat rust?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!