1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
3 years ago
6

1. Do the location of landforms (mountains, trenches, and volcanoes), earthquakes, and mineral deposits have anything in common?

Biology
1 answer:
Lesechka [4]3 years ago
7 0
1- B
2- all of them
3- A
4- B
5- B
You might be interested in
3. An irregularly shaped stone was lowered into a graduated cylinder
MA_775_DIABLO [31]

Answer: the rocks density and the waters density would stay the same. It does not change

Explanation:

4 0
3 years ago
Strontium (Sr) is a silvery metal element that burns an intense color in air and reacts with water. Which of the following eleme
Roman55 [17]

Answer: A

Explanation: Because jsnsnnznzms

7 0
3 years ago
A volcanic eruption produces a large amount of smoke which affects the lungs of animals. Which of these Earth systems interact d
7nadin3 [17]
Hi lovely,

The answer you're looking for would be Biosphere.
8 0
3 years ago
Read 2 more answers
Everything inside the cell including the nucleus
Ludmilka [50]
<span>Everything inside the cell including the nucleus is called the protoplasm. It consists of all organelles, the nucleus, and the cytoplasm. </span>
5 0
3 years ago
DNA is found in every cell of an organisms body.
Andrei [34K]

This is true

May nilbin be with you

6 0
3 years ago
Other questions:
  • Which statement best illustrates a biotic or an abiotic factor that is often found in a city park?
    5·2 answers
  • Plz help! Write the conversion of ATP to ADP as a chemical equation. What are the reactants and products?
    14·1 answer
  • In the equation for the gravitational force between two objects, which quantity must be squared?
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What do all vertebrates have in common?
    10·2 answers
  • What is the main function of the Krebs Cycle?
    14·1 answer
  • HELP ME PLZ! HELP, HELP, HELP! Look at PICS
    11·1 answer
  • Stretch marks are the result of tears in the integumentary layer that contains fibrous connective tissue, elastin, and collagen.
    10·1 answer
  • Why can't DNA leave the nucleus?<br> Because that will risk it getting damaged
    9·1 answer
  • Label the image with the type of plant used in the bouquet.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!