1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
10

The walls of the alveoli are composed of two types of cells. What are these types of cells and their functions?

Biology
1 answer:
I am Lyosha [343]3 years ago
5 0

Answer:

The correct answer is: Type 1 Pneumocytes, and Type 2 Pneumocytes.

Explanation:

The alveoli are structures that form a hollow cavity and are found in the lungs. Alveoli have the very important task of gas exchange, in which deoxygenated blood becomes oxygenated blood to be distributed to every organ in the body.

Alveoli walls are composed of two types of cells:

  • Type 1 Pneumocytes have the function of gas exchange between the capillaries, and for that reason, they are very thin and permeable.
  • Type 2 Pneumocytes have the function to produce surfactant, a substance very important to maintain the elastic recoil of the lungs. Without surfactant, the lungs would collapse.
You might be interested in
Artificially stimulating antibodies to a disease is called _____. immunity viral detection immunization
pantera1 [17]

Answer:

vaccination,immunization

Explanation:

5 0
3 years ago
Which of these descriptions correctly defines the term dna
lianna [129]
DNA<span> is a double helix, while RNA is a single helix. Both have sets of nucleotides that contain genetic information. </span>DNA<span> is a molecule that contains the instructions an organism needs to develop, live and reproduce.</span>
4 0
3 years ago
Need this as fast as Possible!!!!! I will put you for the Brainliest if you answer ALL and Get them RIGHT!!!! HURRY
LUCKY_DIMON [66]
<span>The answer to 10 is A as liquids expand with an increase in temperature. 12. Not able to answer. The answer to 17 is A as a the two different metals expand and contract at different rates when heated and cooled.</span>
8 0
3 years ago
Read 2 more answers
What do you think will happen to the temperature when the amount of water vapor increases?​
Marysya12 [62]
Increasing water vapor leads to warmer temperatures, which causes more water vapor to be absorbed into the air. Warming and water absorption increase in a spiraling cycle. Hope it helps!
7 0
3 years ago
What is the northernmost body of water on the map? What city is closest to that body of water?
MaRussiya [10]

Answer:

l

Explanation:

3 0
3 years ago
Other questions:
  • The fruiting body of a mushroom_____.
    15·2 answers
  • Like chordates, all invertebrates have
    5·1 answer
  • The parasympathetic division of the autonomic nervous system ________. Multiple Choice includes the adrenal medulla utilizes ace
    15·1 answer
  • Describe how this level of organization fits into the organization of the whole body.
    13·1 answer
  • Gyssssss please help meee im in the quizzzzz !!!
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Define renal failure and kindney stone
    9·2 answers
  • Explain three ways in which the abiotic components in your area that affect the biotic components.
    13·1 answer
  • What is a stinging cell that is a distinguishing feature of all cnidarians
    12·1 answer
  • To the base pair given write the correct matching base pair for
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!