Answer:
An egg placed in salt water will float!
Explanation:
In normal tap water, an egg will sink because it's density is greater than the density of water. But, when salt is added to the water, it's density becomes greater than the egg's density. The term used to describe this is "buoyancy."
Answer:
Google is great sometimes
Explanation:
Type your question in google
That it can send signals to diffrent people
Answer: I would say B and C.
Explination: Deposition is material deposited in a new spot. On points B and C, it appears the residue from the water would end up on those river banks.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
