Answer:
Water would not be able to transport nutrients -‐-‐ in plants, or in our bodies -‐-‐ nor to dissolve and transport waste products out of our bodies. ... Cohesiveness, adhesiveness, and surface tension: would decrease because without the +/-‐ polarity, water would not form hydrogen bonds between H20 molecules.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
You need to find moles of the gas, so you would use the ideal gas law:
PV=nRT
Pressure
Volume
n=moles
R= gas constant
Tenperature in Kelvin
n= PV/RT
(1.00atm)(1.35L)/(.08206)(332K) = 0.050mol
Molar mass is grams per mole, so
(3.75g/.050mol) = 75g/mol
Ойлголоо, уучлаарай Ойлголоо, уучлаарай /; coo
Answer:
all the elements in the same period have the same valence electrons.
