All categories

3 years ago

The 3 loops of the circulatory system are

Biology

2 answers:

erica [24]3 years ago

8 0

Answer:

The essential components of the human cardiovascular system are the heart, blood and blood vessels. i think

chubhunter [2.5K]3 years ago

5 0

The essential components of the human cardiovascular system are the heart, blood and blood vessels. It includes the pulmonary circulation, a "loop" through the lungs where blood is oxygenated; and the systemic circulation, a "loop" through the rest of the body to provide oxygenated blood.
Hope this helps!

You might be interested in

What are Examples of real life cell membraine

Novosadov [1.4K]

Answer:

brain to human

Explanation:

hope this helps

3 0

3 years ago

Female gametophytes in angiosperms are hidden, and protected. Where are they found, and what are they also called?.

Scorpion4ik [409]

Answer:

They are usually found in the center and they are called embyro sacs.

Explanation:

3 0

2 years ago

How is a new moon different from a lunar eclipse?

Lubov Fominskaja [6]

The answer is C the moon is between the earth and sun

4 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago

Match the part of the wave to its definition

Artemon [7]

Answer:

high point of a wave = 5

low point of a wave = 4

time between the crest of one wave and the crest of the next wave = 2

vertical distance between a trough and a crest = 1

distance between two crests or two troughs = 3

6 0

3 years ago