1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna1 [17]
4 years ago
11

A forest in North America is rich in flower-bearing trees and coniferous trees. A forest fire damaged all these trees, but their

seeds were still present in the soil. This allowed the trees to regenerate. To which process does this refer?
Biology
1 answer:
ycow [4]4 years ago
3 0
Secondary succession
You might be interested in
Which statement best describes what happened when Constantine tried to establish "New Rome"?
saul85 [17]
D. He was successful in building s new political center in the East, unified by the Christian religion.

This question refers to the Byzantine Empire, which lasted past the fall of the Western Roman Empire.
8 0
3 years ago
At the cellular level, membranes; for the whole organism, the skin is what
Katen [24]

Answer:

Reproduction.

Explanation:

At the cellular level indicate that the living organisms are made up of the smallest building blocks called cell. It refer to unicellular organisms i.e organism with one cell.

At the cellular level, membranes; for the whole organism, the skin is Reproduction because a single parent cell divides into two cells (offsprings), two divides into four cells and so on. It is called cell division and cell reproduction because a single cell skin divides to produce many cells.

4 0
4 years ago
Which statements are correct? Select all that apply.
Stolb23 [73]

Answer:

Engine #1 will accomplish work in about 1/2 the time of Engine #2.

Engine #2 will work about twice as fast as Engine #1.

Explanation:

6 0
4 years ago
Need help ASAP. (biology)
gavmur [86]

A MYSTERIOUS ailment has been devastating the much studied lions of the Serengeti National Park in Tanzania, and scientists said yesterday that it had been identified as canine distemper, a viral disease that causes severe neurological symptoms and death.

4 0
4 years ago
Read 2 more answers
is appearance the only characteristic that determines that determines if an individual plant or animal is suited to its environm
Dovator [93]

No. Yes phenotypes are important for example those with longer legs can run faster and hence escape predators

But genes also code for unseen proteins

For example, if a disease is introduced those with long legs won't survive but those who have the genes which code for the complimentary antibody have the ability to kill the pathogen and hence survive.

4 0
3 years ago
Other questions:
  • What is the same about the electronic structures of lithium and sodium?
    9·2 answers
  • John has two sisters and two brothers. Three of the five children in the family have dark brown hair, one has red hair, and one
    8·1 answer
  • Three reactions involved in the metabolism of different nucleotides are written below. Complete the reactions by moving the subs
    11·1 answer
  • Which features/processes would result from plate movement? Check all that apply.
    12·2 answers
  • Write a hypothesis that explains how the Hawaiian island chain formed. Explain your hypothesis. Describe how your data supports,
    12·1 answer
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Яку роль виконує кора головного мозку в мисленні​
    8·1 answer
  • What is the difference between genetic code and a codon​
    7·1 answer
  • 12. Which of the following in NOT a reason for the government to provide renewable energy subsidies?
    15·1 answer
  • DNA ___________ is important because it ensures that when a cell divides, the two resulting cells have the same genetic code. Pl
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!