1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
3 years ago
15

How many moles of compound are there in the following?

Chemistry
1 answer:
slavikrds [6]3 years ago
8 0

a) (NH4)2SO4 --- 1 mole of it contains 2 moles of N, 8 moles of H, 1 mole of S, and 4 moles of O.

MM = (2 moles N x 14.0 g/mole) + (8 moles H x 1.01 g/mole) + (1 mole S x 32.1 g/mole) + (4 moles O x 16.0 g/mole) = 132 g/mole.

6.60 g (NH4)2SO4 x (1 mole (NH4)2SO4 / 132 g (NH4)2SO4) = 0.0500 moles (NH4)2SO4

b) The molar mass for Ca(OH)2 = 74.0 g/mole, calculated like (NH4)2SO4 above.

4.5 kg Ca(OH)2 x (1000 g / 1 kg) x (1 mole Ca(OH)2 / 74.0 g Ca(OH)2) = 60.8 moles Ca(OH)2

You might be interested in
What is happening to the temperature/pressure during the Deposition Change of State?
jeka94

A material will change from one state or phase to another at specific combinations of temperature and surrounding pressure. Typically, the pressure is atmospheric pressure, so temperature is the determining factor to the change in state in those cases.

Names such as boiling and freezing are given to the various changes in states of matter. The temperature of a material will increase until it reaches the point where the change takes place. It will stay at that temperature until that change is completed.


4 0
3 years ago
During a chemical change items are lost or gained to make new substance true or false​
Otrada [13]

Answer:

If you meant Atoms then the answer is false

5 0
3 years ago
Calculate the silver ion concentration in a saturated solution of silver(i) sulfate (ksp = 1.4 × 10–5).
deff fn [24]

Answer:

= 0.030 M

Explanation:

We can take x to be the concentration in mol/L of Ag2SO4 that dissolves  

Therefore;  concentration of  Ag+ is 2x mol/L and that of SO4^2- x mol/L.

Ksp = 1.4 x 10^-5

Ksp = [Ag+]^2 [SO42-]

      = (2x)^2(x)

      = 4x^3  

Thus;

4x^3  = 1.4 x 10^-5

         = 0.015 M

molar solubility = 0.015 M

But;

[Ag+]= 2x

Hence; silver ion concentration is

= 2 x 0.015 M

= 0.030 M

6 0
3 years ago
In the reaction K2CrO4 (aq) + PbCl2 (aq) 2KCl (aq) + PbCrO4(s), how many grams of PbCrO4 will precipitate out from the reaction
tankabanditka [31]
The answer is 24 grams                       
6 0
3 years ago
In a coffee-cup calorimeter, 100.0 g of H2O and 8.70 grams of Na3PO4 are added. The water had an initial temperature of 24.6 oC.
Alex

Answer:

a.) exothermic

b.) 2,800.6 J

Explanation:

3 0
3 years ago
Other questions:
  • At a certain temperature, the equilibrium constant, K c , Kc, for this reaction is 53.3. H 2 ( g ) + I 2 ( g ) − ⇀ ↽ − 2 HI ( g
    13·1 answer
  • He concentration of pb2+ in a commercially available standard solution is 1.00 mg/ml. what volume of this solution should be dil
    13·1 answer
  • Why Sncl2 is solid but SnCl4 is liquid at room temperature
    15·1 answer
  • For which compound does 0.26 mole weigh 13g
    11·1 answer
  • The melting point of your product is 10 degrees lower than the expected one. What conclusion can you make about the purity of yo
    15·1 answer
  • Many planets are formed by a process called accretion, where chunks of material are drawn to bigger chunks of material and are s
    12·1 answer
  • How many moles of H2O<br> moles of H2O are needed to produce 55.7 moles of H2?
    7·1 answer
  • How do catalysts increase reaction rates? *
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Jen makes a Venn diagram to compare active transport and passive transport.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!