1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
11

A0 is the part of consciousness that involves feeling or sensibility.

Health
2 answers:
harkovskaia [24]3 years ago
8 0

Answer:

emotions

Explanation:

Delvig [45]3 years ago
6 0
If this is a true or false question I would say true???
You might be interested in
What are some ways you can break up with anyone?
sashaice [31]
If your breaking up as couple.then just tell him/her that you need to talk to them then just tell him /her that you and him/her should see new people and should be just friends
3 0
4 years ago
Read 2 more answers
How many chromosomes are contained in the nucleus of each cell in the human body
vlabodo [156]
46 because your parents have have each given you a set of 23 chromosomes and they add up to make 46
4 0
3 years ago
Read 2 more answers
What degree is required to teach Physical education?
Sveta_85 [38]
Teaching you have to go to teaching school
8 0
3 years ago
Read 2 more answers
Is it bad to have a headache all day long?
Rama09 [41]

These migraine or headache symptoms don't need urgent care, but you should let your doctor know if you: Have three or more headaches per week. Have headaches that keep getting worse and won't go away. Need to take a pain reliever every day or almost every day for your headaches.

4 0
4 years ago
Read 2 more answers
State four reasons why a person abuse alcohol.
vredina [299]

Answer:

A need to relax.

Curiosity.

Peer pressure.

Accidental addiction.

A need for energy.

Explanation:

7 0
3 years ago
Other questions:
  • What is the chief reason people choose the foods they eat?
    5·1 answer
  • Is there anything healthy or in healthy about these nutrition facts
    13·2 answers
  • Why do psychiatrists ask how many windows were in your childhood home?
    14·2 answers
  • The development of a continuity plan should begin with ________.
    10·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • Im having a bad day today​
    9·1 answer
  • Hey does anyone know any gymnastic videos for level 2 and 3
    13·2 answers
  • 3<br>does a<br>How<br>healthy<br>help in maintaining<br>happy<br>environment<br>healthy<br>and<br>-​
    15·1 answer
  • What are some things you can do to make sure that you maintain control of your object when you're hitting it up in the air?
    5·1 answer
  • What is aerobic exercise?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!