1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uysha [10]
3 years ago
15

Some one plz help asap

Biology
1 answer:
Lilit [14]3 years ago
3 0

Answer:

Explanation:

The earth turns on its axis every day; it orbits the sun, just like all the other planets in our Solar System. When viewed from space, it turns counter-clockwise.

Because it rotates around the earth at the exact same speed as it rotates around its own axis, so that the same side of the moon is constantly facing the surface of the earth.

Tilt of the earth on its axis is responsible for season formation. The amount of sunlight obtained by various regions on earth surface is regulated by tilt. The places of earth that are facing the Sun and get direct sunlight experiences summers while the others which are facing away from the Sun experience winter season.

You might be interested in
Describe the difference between how sickle cell anemia is inherited versus how best disease is inherited. what causes this diffe
defon
Well, basically we can say that <span>Best Disease expresses itself more through the generations. The reason for that is because it is dominant. While we may say that the allele of the sickle cell anemia its indeed a recessive trait with 0% of chances, Best desease is a dominant trait with 50% of chances.</span>
8 0
3 years ago
Describe one type of factor that controls cell division.
irina [24]
The cell cycle is controlled by many cell cycle control factors, namely cyclins, cyclin-dependent kinases (Cdks) and cyclin-dependent kinase inhibitors (CKIs). Cyclins and Cdks, which are positive regulators of the cell cycle, activate cell cycle factors that are essential for the start of the next cell cycle phase.

Factors Affecting Cell Division
Nutrients. The nutrients present in the cell affect cell division. ...
Genetics. Genetic code regulates cell division. ...
Chemicals. Exposure to toxic chemicals such as pesticides and some cleaning chemicals can cause cell mutation. ...
Stress. Stress affects cell division.
7 0
3 years ago
BRAINLIESTTT ASAP!!!
Reil [10]

1. penicillin 2. lovastatin

Hope this helps don't forget to hit that heart :)

4 0
4 years ago
Read 2 more answers
David is helping to plan a surprise birthday party for his sister Sarah. What lobe is
motikmotik

Answer:

1. Make a List of their Likes and Dislikes for the Surprise Birthday Party.

2. Plan Surprise Birthday Party Location.

3. Invite the family and Friends to the Surprise Birthday Party.

4. Arrange a Surprise Birthday Party Cake.  

5. Plan a Lunch or Dinner Surprise Birthday Party.

6. Plan Games for the Surprise Birthday Event.

7. Pick a personalized theme. Choose a theme based on the guest of honor's favorite movies, books, or TV shows.

8. Book a surprising venue. Source: Peerspace.

9. Send out sneaky invites.

10. Have a strong alibi.

11. Add the sweet finishing touch.

12. Order catering for food and drinks.

13. Turn up the music.

14. Time to decorate.

4 0
3 years ago
Read 2 more answers
Where did the flies maggots come from?
arsen [322]

The fly lays eggs, which turn into maggots. "Maggot" is another word for larva. After a pupal stage, maggots turn into flies.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement correctly compares nucleus acid and carbohydrates
    11·1 answer
  • How is it possible for someone to put an ear to a wall and hear someone in the next room?
    12·2 answers
  • Transcribe the following DNA strand into a mRNA transcript:
    8·2 answers
  • 5) The troposphere of the Earth's atmosphere supports life because it contains
    14·1 answer
  • Kyle is extremely manipulative. He can look anyone in the eye and lie convincingly. His deceit often endangers the safety and we
    11·1 answer
  • Study island 7th grade
    9·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • 9. Explain Using tissue paper to dry sweat in summer ​
    10·1 answer
  • Proteins to be secreted outside the cell are formed at ribosomes on the surface of the ______ endoplasmic reticulum.
    13·1 answer
  • What do sensory neurons do with the information from the receptors ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!