1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gelneren [198K]
3 years ago
7

Two abiotic factors of an environment COULD include A) birds and bees. B) snails and snowfall. C) mosquitoes and mushrooms. D) c

louds and carbon dioxide. clouds and carbon dioxide
Biology
1 answer:
Mandarinka [93]3 years ago
6 0
D. Clouds and Carbon dioxide
You might be interested in
Muchos medicamentos son productos
3241004551 [841]

Answer:I dont know

Explanation:

3 0
2 years ago
An amoeba is a one-celled organism. The cell theory states that which of the following characteristics of amoebas must be true?
Natalka [10]

Answer:

amoeba is a one celled organism

5 0
3 years ago
Cell cycle checkpoints are an important feature of a dividing cell to reduce errors that can occur in various stages of the cell
saveliy_v [14]

Loss of Rb, an important part of the G1-S transition checkpoint, can result in uncontrolled cell cycle progression and cancer. All of the following would mimic loss of Rb except constitutively active Ras GTPase activating protein. Correct answer: letter E.

Constitutively active Ras GTPase activating protein would not mimic loss of Rb, because it would not directly result in uncontrolled cell cycle progression.

<h3>What is Retinoblastoma (RB)?</h3>

Rb is an important tumor suppressor protein that works to inhibit cell cycle progression by preventing the activation of E2F transcription factors. Constitutively active Ras GTPase activating protein would not directly interfere with the Rb-E2F pathway, which is necessary for uncontrolled cell cycle progression and cancer.

Learn more about the cell cycle:

brainly.com/question/2457509

#SPJ4

4 0
1 year ago
Soil formation would take place most rapidly with the weathering of_________
joja [24]
D is the correct anwser
6 0
3 years ago
Read 2 more answers
Chargaff discovered that: the tetranucleotide hypothesis was correct for any organism, the amount of A was equal to the amount o
emmainna [20.7K]

Answer:

the amount of A was equal to the amount of T

amount of C and the amount of G

5 0
3 years ago
Other questions:
  • Order the taxa from largest (first) to smallest (eighth).
    12·1 answer
  • What is the species introduced into ecosystems, intentionally or unintentionally, and usually by humans? some can take over - pe
    15·1 answer
  • Species that are_______species can occur in the same location and are phenotypically different.
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How would the atmosphere in your area change if a disease killed all the plants?
    12·1 answer
  • Using the model presented, what is being formed, B, from the process represented by C? Correctly identify B and C as well as the
    5·1 answer
  • A cell that contains 46 chromosomes arranged in 23 pairs undergoes the process of _____ to produce two new cells, each containin
    11·1 answer
  • Which process is speeded up by rubisco during the light-independent reactions of photosynthesis?
    11·2 answers
  • The reaction below is what process?
    5·1 answer
  • In an individual heterozygous for a single trait, the probability of the recessive allele being present in a gamete is ______. M
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!