1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
11

Which type of rock is non-foliated metamorphic rock?

Biology
1 answer:
yan [13]3 years ago
4 0

Answer:

<em>slat</em><em>e</em><em>,</em><em> phyllite</em><em>,</em><em>schist</em><em> </em><em>and</em><em> </em><em>gnei</em><em>ss</em>

You might be interested in
Which of the following describes the cytoskeleton?​
ASHA 777 [7]

Answer:

Blasirapter

Explanation:

5 0
3 years ago
What is an upwelling? how is it benifical?
neonofarm [45]

Answer:

is a process in which deep, cold water rises toward the surface. ... Water that rises to the surface as a result of upwelling is typically colder and is rich in nutrients. These nutrients “fertilize” surface waters, meaning that these surface waters often have high biological productivity

Explanation:

8 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
How is oxygen taken into the body?​
UNO [17]

Answer:

Oxygen enters the body in the mouth and nose, passes through the larynx and the trachea. The trachea splits into two bronchial tubes, which lead to smaller tubes that lead to 600 million alveoli, which are small sacs surrounded by capillaries. The capillaries take oxygen into the arteries, and the oxygen-rich blood is then pumped into every cell of your body. Once the oxygen has been absorbed, carbon dioxide and water are eliminated through the lungs.

Explanation:

good luck!

6 0
2 years ago
White-tailed deer eat green plants, acorns, fruits, nuts, and twigs.
Ainat [17]

Answer:herbivore

Explanation: herbivores don’t eat meat and they are prey so the deer is also low on the food chain.

4 0
2 years ago
Read 2 more answers
Other questions:
  • What leads to the formation of a windchill factor?
    6·2 answers
  • What’s the meaning of existence
    7·2 answers
  • If a cell with 6 chromosomes undergoes mitosis, how many chromosomes will each of its 2 daughter cells have?
    15·1 answer
  • What is an abiotic factor?
    8·1 answer
  • A dna molecule containing 32% thymine would contain how much cytosine?
    10·1 answer
  • What four type of animals
    12·1 answer
  • The geological time scale represents the history of what?
    12·1 answer
  • Define "Diffusion"..
    13·2 answers
  • The author mentions that Shine made several mistakes in her experiment. Describe one major mistake that Shine made.
    13·1 answer
  • 14. What type of symbiosis do the bacteria and the legumes plants have?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!