1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
10

1. Define estuary . .

Biology
2 answers:
AnnZ [28]3 years ago
7 0
Answer from internet

yan [13]3 years ago
6 0

The mouth of a large river, where the river meets the sea

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Which nucleic acid is translated to make a protein? hints which nucleic acid is translated to make a protein? dna rrna mrna trna
yaroslaw [1]
The answer is mRNA. Translation is the process of reading the code in mRNA in the ribosomes to make protein. The ribosome is the organelle responsible for making proteins. The mRNA is translated from the language of nucleic acids (nucleotides) to the language of proteins. 
7 0
3 years ago
Plants manufacture glucose ____
djverab [1.8K]

Plants manufacture glucose during photosynthesis. Which would be the process that plans use to make food using sunlight.

3 0
2 years ago
A new kind of tulip is produced that develops only purple or pink flowers. Assume that flower color is controlled by a single-ge
Sophie [7]

Answer:

a. purple allele (C) = 0.609, pink allele (c) = 0.391

b. purple homozygotes = 371, pink homozygotes = 153, heterozygotes = 476

Explanation:

Given -

Purple flowers - 847

Pink flowers - 153

The frequency of recessive genotype i.e

q^ 2 = \frac{153}{1000} \\q^ 2 = 0.153\\

Frequency of recessive allele i.e q is equal to

q = \sqrt{0.153} \\q = 0.391

As per hardy Weinberg's first equilibrium equation -

p + q = 1\\p = 1-q\\p = 1-0.391\\p = 0.609

Frequency of purple homozygous species

= p^2\\= 0.609^2\\= 0.371

Number of purple homozygous species = 0.371 * 1000= 371

Number of pink homozygous species = 0.153 * 1000= 153

Heterozygous species is equal to

(1-0.371-0.153)* 1000\\= 0.476 * 1000\\= 476

5 0
3 years ago
Read 2 more answers
which statements are true of heterogeneous mixtures? 1) they settle out. 2) the proportions of solute to solvent may vary. 3) th
Sindrei [870]
The statements that are true of heterogeneous mixtures are: they settle out and the proportions of solute to solvent may vary. The correct answer is option A. 1 and 2. Heterogeneous mixtures are considered mixtures wherein the components are not uniform and still retain their properties. Characteristics of heterogeneous mixtures are: the ratio of solute and solvent is not equal, the substances can be separated physically and they still retain their properties even if mixed with another substance. 
5 0
2 years ago
Read 2 more answers
Other questions:
  • Using your knowledge of organic molecules and the following experimental situation answer the next question. Experiment: A cello
    15·1 answer
  • Humans have had a pattern of _____________ growth.
    15·2 answers
  • This code is found in a type of nucleic acid called
    14·1 answer
  • The genes for sex-linked traits are carried on either the X or Y chromosome. Duchenne muscular dystrophy (DMD) is a recessive, s
    11·2 answers
  • the gemone of an organism is its total genetic material what aspect of the gemone can and cannot be determined through karyotypi
    15·1 answer
  • Which of the following groups of organisms in an ecosystem by the amount of energy resource provides
    7·1 answer
  • Which of the following IS found in a bacteria cell?
    13·1 answer
  • Which tissue is made of more than one type of cells?
    7·2 answers
  • To ensure that a human gene is translated properly in a bacterial cell, you should clone the _____________ for the gene instead
    12·1 answer
  • Scientists often classify organisms based on their ability to perform certain processes.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!