1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
postnew [5]
3 years ago
12

An oxide of niobium has a cubic unit cell in which there are oxide ions at the middle of each edge and niobum atoms at the cente

r of each face. what is the empirical formula of this oxide?
Chemistry
2 answers:
ololo11 [35]3 years ago
8 0

Question 1:

1. One form of niobium oxide crystallizes in the unit cell shown above.

A. How many niobium atoms per unit cell? 3

B. How many oxygen atoms per unit cell? 3

C. What is the formula of niobium oxide? Nb2O5

Answer: A) 3 B) 3 C) Nb205

Question 2:

2. Quartz (left) and glass (right) are both forms of silicon dioxide. A piece of quartz breaks into a collection of smaller regular crystals with smooth faces. A piece of glass breaks into irregular shards. Use molecular structures to explain why the two solids break so differently. Select all that apply.

1. the bonding and geometry in quartz shows regular repeating patterns *

2.  the bonding and geometry in quartz shows irregular repeating patterns

3. the bonding and geometry in glass shows irregular repeating patterns *

4. the atomic geometries of the two solids can explain why they break so differently  *

5. the atomic geometries of the two solids cannot explain why they break so differently

6. the bonding and geometry in glass shows regular repeating patterns

Answer: 1,3,4

3. Solid silver adopts a face-centered cubic lattice. The metallic radius of a silver atom is 144 pm.

a. How many silver atoms occupy one unit cell of solid silver? 4

b. Calculate the length (in pm) of one side of the unit cell. 407

c. Calculate the volume (in m3) of one the unit cell.  6.74 x10^-29

d. What percentage (expressed to four significant figures) of the volume is empty? 25.95

Answer: a)4 b)407  c)6.74 x10^-29   d)25.95

4. Why hexane is insoluble in water? Select all that apply.

1. Water is polar solvent. *

2. Polar solvents dissolve both polar and non-polar compounds.

3. Polar solvents dissolve only polar compounds. *

4. Solubility does not depends on the polarity of the solvents and reagents.

5. Hexane is non-polar compound. *

Answer: 1,3,5

<3 goodluck

Lynna [10]3 years ago
3 0

Answer:

Empirical formula: NbO_2

Explanation:

  • One oxide ion in the middle of each edge => cubes have 12 edges => O=12
  • One niobium atom at the center of each face => cubes have 6 faces => Nb=6

Cell formula: Nb_6O_{12}

Empirical formula: NbO_2

<em>This formula corresponds to a niobium valence of +4 </em>

You might be interested in
Describe the day of June 21 at the North Pole in terms of daylight and darkness <br> ( science )
frosja888 [35]
On June 21, as seen from the North pole ...

-- the sun has been up, and it's been light outside,
for the past three months ... ever since March 21 . 

-- The sun won't set, and it won't be dark outside,
for another three months ... until September 21.

-- Here at the North pole, it stays daylight for six months straight.
Today, on June 21, we're exactly halfway through the period of
continuous daylight.
7 0
3 years ago
How do the mass and height of an object affect the gravitational potential energy?
marin [14]

Answer:

B. mass and height have the same effect on gravitational potential energy.

Explanation:

Both mass and height have the same effect on the gravitational potential energy of body.

Gravitational potential energy is the energy of a body due to that of another body. It usually the energy at rest in a body.

It is mathematically expressed as;

 G.P.E  = m x g x h

m is the mass

g is the acceleration due to gravity

h is the height

We see that both the height and mass are directly proportional to the gravitational potential energy and as such, they have the same effect.

5 0
3 years ago
ObIel WiLll unt COl.. USSMS A certain chemical reaction releases 31.2 kJ/g of heat for each gram of reactant consumed. How can y
aleksandr82 [10.1K]

Answer:

The expression to calculate the mass of the reactant is m = \frac{1.080kJ}{31.2kJ/g}

Explanation:

<em>The amount of heat released is equal to the amount of heat released per gram of reactant times the mass of the reactant.</em> To keep to coherence between units we need to transform 1,080 J to kJ. We do so with proportions:

1,080J.\frac{1kJ}{10^{3}J } =1.080kJ

Then,

1.080kJ=31.2\frac{kJ}{g} .m\\m = \frac{1.080kJ}{31.2kJ/g}

5 0
3 years ago
Read 2 more answers
Minor partial melting in the asthenosphere causes liquid magma to form. If the molten rock is able to move at all, it will leave
Bad White [126]
I don’t understand the question be more specific or take a picture
6 0
3 years ago
Minerals can be easily identified by their?
kotegsom [21]
Im pretty sure it would be d.
7 0
3 years ago
Read 2 more answers
Other questions:
  • How many moles of a gas sample are in a 20.0 L container at 373 K and 203 kPa? The gas constant is 8.31 L-kPa/mol-K. 0.33 moles
    15·2 answers
  • What mineral mostly form through chemical precipitation?
    8·1 answer
  • How many grams of testosterone, C19H28O2 (288.4 g/mol), must be dissolved in 299.0 grams of benzene to reduce the freezing point
    6·1 answer
  • Which two particles are found in the nucleus of an atom?
    5·2 answers
  • What determines the average kinetic energy of the particles in a gas? A. the number of collisions B. the number of particles C.
    6·2 answers
  • Salt solutions can be __________ to give solid salts. What word completes this sentence?
    14·1 answer
  • Which of the following are the types of RNA?
    8·2 answers
  • The denser and thicker a liquid is, the higher the buoyancy of an object is. In other words, if the density of a certain fluid i
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • PLEASE HELP ASAP WILL GIVE BRAINLIEST
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!