1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Studentka2010 [4]
3 years ago
14

In a mixture, the ingredients intermingle and

Chemistry
2 answers:
Marta_Voda [28]3 years ago
7 0
The best and most correct answer among the choices provided by your question is the first choice or letter A.
<span>
In a mixture, the ingredients intermingle and do not react with other or chemically bond to each other.</span>


I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
Andreyy893 years ago
3 0

Letter A. do not react with other or chemically.

You might be interested in
A 3.50 amp power supply is used to deposit chromium from a solution of CrCl3. How long will it take to deposit 100.0 grams of ch
Norma-Jean [14]

Explanation:

The given data is as follows.

   Current (I) = 3.50 amp,        Mass deposited = 100.0 g

  Molar mass of Cr = 52 g

It is known that 1 faraday of electricity will deposit 1 mole of chromium. As 1 faraday means 96500 C and 1 mole of Cr means 52 g.

Therefore, 100 g of Cr will be deposited by "z" grams of electricity.

                z \times 52 g = 96500 \times 100 g

                         z = \frac{96500 \times 100 g}{52 g}

                            = 185576.9 C

As we know that, Q = I × t

Hence, putting the given values into the above equation as follows.

                      Q = I × t

           185576.9 C = 3.50 amp \times t  

                      t = 53021.9 sec

Thus, we can conclude that 100 g of Cr will be deposited in 53021.9 sec.

3 0
3 years ago
4. "Metals are conductor of electricity"prove​
Nikolay [14]

Answer:

Hey mate.......

Explanation:

This is ur answer......

<em>Metals are an excellent conductor of electricity and heat because the atoms in the metals form a matrix through which outer electrons can move freely. Instead of orbiting their respective atoms, they form a sea of electrons that surround the positive nuclei of the interacting metal ions.</em>

Hope it helps!

mark me brainliest pls......

Follow me! :)

8 0
3 years ago
Is C3HNO an organic molecule
antoniya [11.8K]

Answer:

Yes.

Explanation:

8 0
4 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
The<br>of a chemical reaction is the maximum amount of product that can be produced​
Troyanec [42]

Answer= Maximum amount of product that could be obtained under ideal conditions from a given amount of reactants.

Explanation:

The theoretical yields is the ideal maximum amount of a product that can be produced during a chemical reaction while the limiting reactant is the reactant that determines the maximum amount of product that can be formed. mitgliedd1 and 61 more users found this answer helpful.

5 0
3 years ago
Other questions:
  • What is the hydronium ion concentration of a solution whose pH is 7.30
    12·1 answer
  • The metallic radius of an aluminum atom is 143 pm. What is the volume of an aluminum atom in cubic meters?
    15·1 answer
  • Is 4Na a molecule or an atom
    8·1 answer
  • Given an activity series in which the most active metals are at the top of the list and the least active metals are at the botto
    12·1 answer
  • You and a friend each decide to build the same model airplane. After the airplanes are built, you decide to conduct an investiga
    14·1 answer
  • PLZ HELP! I will give brainliest for best answer!!!!
    14·1 answer
  • Which of the following elements is most nonmetallic - most wanting of electrons?
    11·1 answer
  • Determine the number of miles of C in each sample​
    15·1 answer
  • 1 Condensation
    15·1 answer
  • Which of the following is true about gravity? Select all that apply.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!