1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
10

In order for an organism to survive, it must do what?

Biology
2 answers:
SashulF [63]3 years ago
5 0
A. find food and water
arlik [135]3 years ago
5 0

Answer:

I can confirm it is:

A. Find food and water

You might be interested in
What is a controlled experiment​
kirill115 [55]
An experiment or observation designed to minimize the effects of variables
8 0
3 years ago
Select the correct locations in the images.
Arlecino [84]

Homozygous individuals' genotype is composed of the same type of alleles. In this example, the offspring with homozygous alleles for the smooth pod trait are SS.

<h3>What is homozygous genotype?</h3>

The term homozygosis is used to refer to the genotype of individuals that carry the same type of alleles.

Let us remember that alleles are the alternative forms in which a gene can be expressed.

To understand the concept, let us think about a diallelic gene, which is a gene that has two types of alleles.

  • Dominant allele → let us represent it with an A
  • Recessive allele → let us represent it with an a

Homozygous individuals will have two alleles of the same type

  • AA → homozygous dominant because it carries the dominant alleles
  • aa → homozygous recessive because it carries the recessive alleles

Heterozygous individuals are those that carry two types of alleles, dominant and recessive → Aa

In the exposed example,

  • the dominant allele → S → codes for smooth
  • the recessive allele → s → codes for constricted

Cross 1: Two homozygous individuals are crossed

Parentals)         SS                    x               ss              

Phenotype) smooth pods                   constricted pods

F1) The first generation is composed only of heterozygous inviduals → Ss

The whole generation has smooth pods because they carry the dominant allele which expresses the dominant phenotype.

Cross 2:  Two heterozygous individuals are crossed

Parentals)       Ss x Ss

Phenotype) smooth pods

F2) The second generation is composed of

  • 1/4 = 25% homozygous dominant indiviudals →<u> SS → smooth</u>
  • 1/2 = 50% heterozygous inviduals → Ss → smooth
  • 1/4 = 25% homozygous recessive indiviudals → ss → constricted

The offspring with homozygous alleles for the smooth pod trait are SS.

You can learn more about homozygous genotype at

brainly.com/question/1084870

brainly.com/question/14804681

brainly.com/question/22405088

#SPJ1  

4 0
2 years ago
What is aquaculture?a. Farm production of fish or seafood by raising animals in tanks, ponds, or ocean net pens.b. A fishery tha
joja [24]

Answer: Option A - Farm production of fish or seafood by raising animals in tanks, ponds, or ocean net pens.

Explanation:

Aquaculture is the cultivation of aquatic produce such as aquatic plants, fish, and other aquatic animals.

7 0
3 years ago
Read 2 more answers
Hellpp with this ill give brainliest
Ann [662]

Answer:the answer is A

7 0
3 years ago
Hi, I need help with my homework and it's on the carbon cycle.
Anika [276]
The correct answer is 2, or Plants incorporate carbon from carbon dioxide into organic molecules.
3 0
2 years ago
Other questions:
  • What is a mass of a feather
    6·2 answers
  • Seasonal conditions influence the life cycle of marine organisms. Many animals that inhabit lakes have a reproductive process th
    5·2 answers
  • Which of these would not be a VALID scientific theory?
    7·2 answers
  • How many molecules of atp may be produced​
    14·1 answer
  • A person can be tested for the allele that causes Huntington’s disease because the ___________________ of that allele is differe
    11·1 answer
  • In which structure in the ovary does an egg mature?
    10·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • The reactants for photosynthesis, carbon dioxide and
    12·1 answer
  • Please help me I don't really understand
    7·1 answer
  • Life's large molecules, or macromolecules, are classified into what four categories?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!