1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
4 years ago
6

Some individuals believe that the genetic engineering of crops has the potential to save lives and prevent starvation. Others be

lieve the risks are too great.
Do you think the benefits of genetically modified foods are greater than the risks? Explain and give evidence in your answer.

Disadvantages
Genetically-modified foods are common since introduced in 1994. It is likely that you have eaten these foods
without knowing about it. Some types of genetically-modified foods have the potential to cause big
problems. Some of these problems include:
● Some types of genetically-modified food are approved only for animal feed, not for human
consumption. The crops look exactly the same and could be mixed up. In 2000, a modified corn
product approved only for animals was found in a fast food company’s taco shells.
● Certain crops contain genes that make them resistant to certain antibiotics. If these plants bred
naturally with others, the antibiotic-resistant genes could spread and eventually cause problems with
certain bacteria. These bacteria would be harder to kill with existing antibiotics.
● Some genetically-modified foods contain different proteins that some people are allergic to. There is
no way of knowing the protein exists in the food item if it is not labeled.
● Crops that are engineered to produce toxins to kill insects sometimes kill other species inadvertently.
This includes some important pollinators like butterflies and bees.
● Some individuals believe that the genetic engineering of crops has the potential to save lives and
prevent starvation. Others believe the risks are too great.
Biology
1 answer:
allochka39001 [22]4 years ago
8 0
I believe that the disadvantages outway the advantages. Afterall we want to stay healthy and live longer. 
You might be interested in
Global climate change
Drupady [299]

Answer:

ok yes it changes but what is the question

Explanation:

8 0
3 years ago
Read 2 more answers
Humans are the selective agent in which type of procces, artificial selection or natural selection
Aleonysh [2.5K]
Natural Selection, unless you were born in a lab which would be unnatural/artificial, and not too likely with today's technology. (Maybe one day.)
4 0
3 years ago
Explain how it would be possible to have a change in a single base of DNA, but have the protein NOT change and be functional.
Y_Kistochka [10]
A chromosome I believe
5 0
3 years ago
If the food on the island is small seeds, what finch is best adapted? Explain why
jeka57 [31]

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

7 0
2 years ago
What is the difference between coniferous and deciduous trees
NeX [460]

Answer:

Explanation:

Deciduous and Coniferous trees are both Woody plants and can both be found in the forest, but there are significant differences between them including-

1) The leaves of deciduous trees change color and are shed seasonally while the needles of Coniferous trees are not lost seasonally, neither do they turn pale

2) Deciduous trees are flowering plants and so they bear their seeds in fruits while Coniferous trees are gymnosperms and so bear their seeds in cones.

3) Coniferous trees possess needles in lieu of leaves while deciduous trees possess broad leaves

4) Examples of Coniferous trees are firs, junipers, redwoods, spruces, and pines etc. while examples of deciduous trees are oak, maple, and elm etc.

3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which statement about scientific theories is true?
    12·2 answers
  • PLEASE ANSWER FAST URGENT
    8·1 answer
  • Which statement describes the role of the organism indicated by the blue arrow in the food web?
    8·1 answer
  • Do you think that the frequency of echolocation sounds from bottlenose dolphins will be higher or lower than that of the blue wh
    11·1 answer
  • Why do those in forestry need to be able to perform basic operations without the aid of digital technology?
    11·1 answer
  • Select the correct location on the image.
    7·2 answers
  • Will someone please help me??
    10·1 answer
  • A blank cell that becomes specialized during development
    12·2 answers
  • Draw a line to connect the following terms to their definitions. PLZ HURRY!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!