1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
3 years ago
13

The most common phenotype or allele for a gene in a population is referred to as

Biology
1 answer:
Tanzania [10]3 years ago
5 0
The most common phenotype or allele for a gene in a population is referred to as the wild-type. The wild type denotes to the phenotype of the classic form of a species as it arises in Mother Nature. In the beginning, the wild type was inattentive as a creation of the standard normal allele at a locus in difference to that created by a non-standard mutant allele.
You might be interested in
A series of coral reefs is located near a coastline in 3-5 sentences construct an argument about how people can help prevent ero
iren2701 [21]

Answer:

A coral reef can be described as an ecosystem of the ocean which is made up by reef-building corals. Coral reefs benefit the environment in a number of ways, one of them is protecting the shoreline. <em><u>Coral reefs tend to absorb most of the waves from the ocean and so help the coastline from erosion. It reduces the chances of ocean water waves to destroy the crops and buildings nearby and hence prevents erosion. </u></em>

<em><u></u></em>

6 0
3 years ago
Which particles are located<br> in the nucleus?
pentagon [3]

Answer:

\boxed {\boxed {\sf Protons \ and \ neutrons }}

Explanation:

In an atom, there is a dense center known as the nucleus. It is made up of two subatomic particles: <u>protons</u> and <u>neutrons</u>. The protons have a positive charge and the neutrons have no charge, so overall the nucleus is positively charged.

The third subatomic particles, negatively charged electrons, are located around the nucleus in a cloud.

The particles in the nucleus are \tt protons \ and \ neutrons.

7 0
3 years ago
in the cell, part of the Golgi appartus will pinch off and move away. what is the function of this process?
seropon [69]
Parts of the golgi apparatus break off into transport vesicles. These vesicles are especially important after protein synthesis when finished products of proteins need to be transported elsewhere within the cell's membrane or outside the cell.
6 0
3 years ago
Read 2 more answers
Which species will most likely survive if the earths temperature increases
Shtirlitz [24]

If not multiple choice, Probably insects and humans would last the longest

4 0
3 years ago
•
rewona [7]

Answer:

who are you ? hit you hell

8 0
3 years ago
Read 2 more answers
Other questions:
  • A threadlike structure of dna that carries genes is called
    12·2 answers
  • Each muscle fiber contains tiny threads called _____, which are made of myosin and actin.
    12·2 answers
  • Your classmate states that only precious minerals,such as diamonds,are valuable. Based on your lesson on the rock cycle, you
    10·1 answer
  • Arthropods invaded land about 100 million years before vertebrates did so. This most clearly implies that
    15·1 answer
  • What is true about innate behavior, such as the tendency of bulldogs to want to chase larger animals or cars?
    10·1 answer
  • Describe characteristics that determine the fitness of the American Bullfrog.
    7·1 answer
  • What is the difference between sensory, motor and relay neurons?​
    7·1 answer
  • The enzyme polynucleotide phosphorylase randomly assembles nucleotides into a polynucleotide polymer. You add polynucleotide pho
    15·1 answer
  • In 2006, the United States government created the largest marine wildlife preserve in the world. The preserve is located around
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!