1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
12

Explain the visual process, including the stimulus input, the structure of the eye, and the transduction of light energy.

Biology
1 answer:
ehidna [41]3 years ago
7 0
The energies we encounter as noticeable light are a thin cut from the expansive range of electromagnetic radiation. Our tactile experience of light is resolved to a great extent by the light vitality's wavelength, which decides the tone of a shading, and its power, which impacts splendor. After light enters the eye through the student, whose size is managed by the iris, a camera-like focal point centers the beams by changing its ebb and flow, a procedure called convenience, on the retina.
You might be interested in
Which era makes up the vast majority of Earth's history?
MAXImum [283]

Answer:

Precambrian era is the longest era in the Earth's history.  It began 4600 million years ago and ended about 540 million years ago.

Explanation:

5 0
3 years ago
Read 2 more answers
If one nerve stimulus arrives at a muscle fiber so soon that the fiber does NOT relax at all from the previous twitch, the most
BaLLatris [955]

Answer:

Complete Tetanus

Explanation:

The nerve stimulus arrives at the fiber at such a rapid pace that there is no decrease in tension between stimuli detected. This results in a tectanic contraction that is fused (complete) . Thus the muscle fiber does not relax at all due to this complete tetanus.

6 0
3 years ago
Why are injections given in muscle rather than subcutaneously?
Romashka-Z-Leto [24]
Intramuscular injections are absorbed faster than subcutaneous injections. This is because muscle tissue has a greater blood supply than the tissue just under the skin. Muscle tissue can also hold a larger volume of medication than subcutaneous tissue.
3 0
3 years ago
Read 2 more answers
WILL MARK AS BRAINLIEST 35 POINTS!!!! What happens if one type of plant in an ecosystem dies out from disease?
marissa [1.9K]

the animals eating the plants would need to eat other plants

6 0
4 years ago
Read 2 more answers
Bacteria in the soil converts this nutrient into a usable form. Plants take up the usable nutrient through the soil and assimila
allochka39001 [22]
It's the nutrient cycle- we just did this in Biology
4 0
4 years ago
Read 2 more answers
Other questions:
  • A student in your physiology lab is thirsty and decides to sneak a drink of deionized or distilled water. the student drinks a f
    5·1 answer
  • Which of the following criteria do astronomers use to classify an object as a planet
    10·2 answers
  • What is the complementary strand of bases for a strand with the bases TACGTT
    15·1 answer
  • Why did Mendel prevent his plants from self-pollinating?
    10·2 answers
  • In Stage 1 of his lab, Gunther adds 20 mg of solute into a solution. He stirs it and it completely dissolves. In Stage 2, he add
    12·2 answers
  • Which is responsible for muscle pain felt after repeatedly lifting weights
    8·1 answer
  • What is the responsibility of circulatory system​
    12·2 answers
  • Wich structural adaptation would help a plant survive better in a shady environment
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The movement of organisms from one place to another is called ___________. *
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!