1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
4 years ago
5

List cell organelles that are never found in prokaryotic cells

Biology
1 answer:
lyudmila [28]4 years ago
4 0
The cell membrane
Ribosomes 
Cytoplasm and dna
You might be interested in
Can someone please tell me a simple definition of genetic information.
lianna [129]
Of or relating to genes or heredity.
"all the cells in the body contain the same genetic information"
3 0
3 years ago
Which of the following describes the role of photosynthesis in the carbon cycle?
Daniel [21]

Answer:

The answer would be E

Explanation:

The transfer of carbon from the atmosphere to the biosphere is the role of photosynthesis in the carbon cycle.

3 0
3 years ago
The phase change of an apical meristem from the juvenile to the mature vegetative phase is often revealed by A. a change in the
Tomtit [17]

A change in the morphology of the leaves generated can frequently be used to detect when an apical meristem transition from the juvenile to the mature vegetative phase.

<h3><u>Apical meristem: What is it?</u></h3>

The growth zone within the tips of new shoots and leaves as well as the root tips of plants is known as the apical meristem. One of three meristem types, or tissues that can differentiate into distinct cell types, is the apical meristem. Plant growth takes place in the meristem tissue.

Apical growth is defined as taking place at the top and bottom of the plant. While lateral meristems are found between branches, intercalary meristems grow in girth like those of woody plants. The apical meristem is essential for expanding both the roots' and leaves' access to light energy and nutrients. For plants to succeed, they need to grow in both of these directions.

Learn more about apical meristem with the help of the given link:

brainly.com/question/798517

#SPJ4

4 0
2 years ago
The three DNA fragments above are about to be sequenced. What is the nucleotide sequence that will be recorded from this synthes
KIM [24]

Answer:

5'-AATGGCGTCCTGATCCCGG-3

8 0
3 years ago
What would you expect to be different about a muscle cell in an animal? Why?
nekit [7.7K]
Have a lot of mitochondria so that more respiration providing muscles with more energy for muscle contraction




Hope it’s useful
3 0
3 years ago
Other questions:
  • All except mercury are solids at room temperature
    5·1 answer
  • Which factors can cause secondary succession in nature?
    8·1 answer
  • Do prokaryotic cells have nucleic acid?
    6·1 answer
  • The replica fossil you just created models the actual formation of fossils on Earth. In your replica, what do the clay and the p
    7·1 answer
  • Which of these is not an environmental effect of deforestation?
    15·2 answers
  • What do the lichens and mosses produce to break down rocks to begin the formation of soil?
    8·1 answer
  • 3. The change in temperature during summer is due to<br> *
    8·1 answer
  • Farm pig name ideas for girl and boy please. Thanks so much
    9·2 answers
  • Substances that can rust or
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!