1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixas84 [53]
3 years ago
8

How do you isolate and copy the COI gene from your salmon sample?

Biology
1 answer:
KIM [24]3 years ago
5 0

Answer: 1-4-5-6

Explanation: Polymerase Chain Reaction or PCR is a lab technique used to make numerous copies of determined section of a DNA. The process requires 5 ingredients to perform:

1) The DNA template to be copied, which can be obtained by disrupting the nuclear membrane of a cell and releasing its components into a solution;

2) Short sequences of DNA, called primers, designed to be complementary to the DNA to be copied;

3) DNA nucleotide bases, also known as dNTPs (A, T, C and G);

4) Taq polymerase enzyme;

5) Buffer to ensure optimal conditions to the reaction;

PCR involves three stages:

  • Denaturing: this stage takes 15 to 30 seconds and consists of putting the DNA and the other ingredients in a thermal cycler, heated to 94-95°C. In that temperature, the DNA to break into two strands, in a process called Denaturation;
  • Annealing: the temperature is reduced to 50-65°C, so the primers can attached itself to a specific location on the stranded DNA. This step initiates the synthesis, because the polymerase enzyme can only add bases to a double strand of DNA. Once bounded, it takes 10 to 30 seconds to make a new complimentary strand of DNA from the model;
  • Extending: In this stage, the temperature is increased to 72°C, which enables the Taq polymerase enzyme. This enzyme comes from a bacteria, which supports high temperatures, and has a role of builiding the complimentary strand by binding the primer and adding the DNA bases to the single strand. This creates a new molecule of DNA. The time this step takes depends on the length of the DNA to be copied;

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
A scientist is on-site studying a coral reef food web. What can you infer about her location? *
mario62 [17]

Answer:

she is in a submersible near the ocean floor.

3 0
3 years ago
Choose all the answers that apply.
puteri [66]

<u>Answer</u>: all the answers apply

Cardiovascular disease can affect both the heart and blood vessels and the most common sign is chest pain. It is the leading cause of death in the United States with it being responsible for one in every four deaths. Quitting smoking will improve the health of the heart and blood vessels as well as greatly reducing the risk of recurrent heat attack and cardiovascular death.

7 0
3 years ago
Read 2 more answers
Which of the following is NOT a reason for honeybee colonies to die off
Strike441 [17]

Answer:

no Queen

Explanation:

sometimes bees will actually kill their Queen if she does not produce any more bees so they will huddle around her and vibrate enough heat to kill her purposefully now they will die if they don't find a b Queen for a long time but is not often it is most likely will die from toxic things and pesticides or mites

4 0
3 years ago
Which of these is not a characteristic of all living things?
maksim [4K]

Answer: B

Explanation: All living things have one or more cells

5 0
3 years ago
Read 2 more answers
Other questions:
  • carla is reading an article about a certain species of bacteria that can grow on the leaves of common house plants. the article
    15·2 answers
  • What are the functions of micronucleus and macronucleus in paramecium?
    9·1 answer
  • SOS. HELP.
    15·1 answer
  • 1. Mitosis is used to make new
    5·2 answers
  • Hurricanes are more destructive than tornados due to _____.
    12·2 answers
  • ASAP
    11·2 answers
  • There are other kinds of enzymes in your digestive system, how do enzymes affect digestion​
    9·2 answers
  • Define 4 types of teeth(incisors,canines, premolars and molars)
    11·1 answer
  • Help plzzzzzzzz………………
    15·1 answer
  • What is most likely the cause of this difference from the rest of the population
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!