1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
8

if more salts are added to water, it increases the ________ of the water. a-salinity b-temperature c-solubility d-reactivity

Biology
2 answers:
vovikov84 [41]3 years ago
7 0
A. Salinity, that's the measurement of salt levels within water, or other liquids
kirill [66]3 years ago
3 0
A - Salinity because salinity is how much salt is in water and adding more would increase the salinity.

You might be interested in
Which molecules make up carbohydrates?
soldi70 [24.7K]

Answer:

b

Explanation:

4 0
2 years ago
The organic chemicals that help cell membranes to conserve internal fluids are:
guajiro [1.7K]

<u>Answer</u>:  

The organic chemicals that helps cell membranes to conserve the internal fluids are phospholipids.

<u>Explanation</u>:

Phospholipids are used to form plasma membrane of the cell. Plasma membrane surrounds the cell contents like various cell organelles, nucleus, ribosomes and proteins. A phospholipid molecules is made up if a polar head containing a phosphate group and the two non-polar tails made of long chains of hydrocarbon of fatty acids.

The another name for plasma membrane is phospholipid bilayer. The polar head is hydrophilic that interactes with polar environment while facing outside the bilayer while the non-polar tail is hydrophobic in nature which makes the internal hydrophobic region of cell membrane which faces inside the bilayer.

8 0
3 years ago
The _____ system is the network of nerve fibers that connects the central nervous system to all other organs in the body.
chubhunter [2.5K]
The nervous system.
5 0
3 years ago
A tRNA molecule has two important features: an _______ at one end an ______ at the other.
irina1246 [14]
Try using this website to answer your question



https://www.wiley.com/college/boyer/0470003790/structure/tRNA/trna_text.htm


8 0
3 years ago
Bacterial species have evolved over millions of years to fill almost every available environmental niche on this planet. Despite
AVprozaik [17]

Answer:

1. Glucose breaks down into two pyruvates. CATABOLIC

2. Ammonia is added to glutamate to form glutamine. Anabolic

3. Four amino acids join to form tetrapeptides. Anabolic

4. A uracil base is added to an mRNA strand by RNA polymerase. Anabolic

5. Starches are digested into individual glucose molecules. CATABOLIC

6. Ribose and inorganic phosphate join together to form a nucleotide base. Anabolic

Explanation:

Chemical reactions are classified as anabolic and catabolic depending on whether they form or disintegrate structures, yielding energy to the medium or taking energy from the medium.

Anabolic reactions are those that take energy from the environment and therefore synthesize very complex molecules, of various bonds such as glycogen, starch, among other polysaccharides.

On the other hand, catabolism leads to the destruction of the unions of a chemical product, that is why they have greater entropy and is thus the greatest disorder.

Catabolism releases energy to the environment, it releases it.

For an anabolic reaction to happen, there must be a catabolic one, since it takes the energy released by catabolism, and for a catabolism to happen, an anabolism must first have arisen, that is, the formation of a molecule or particle that is dissociates.

8 0
3 years ago
Other questions:
  • Balance the equation:<br> Cd + H2SO4→ __CdSO4 + H2<br><br><br> a. 1<br> b. 2<br> c. 3<br> d. 4
    9·1 answer
  • At what age does marfan syndrome occur
    10·2 answers
  • Is atmospheric nitrogen easily used by plants​
    13·1 answer
  • Gray-banded kingsnakes are endangered species which are most vulnerable to private and commercial pet dealers. New Mexico has la
    10·2 answers
  • A plant that has flowers containing both sexes is said to be:
    7·1 answer
  • What is the major way in which local farms help reduce greenhouse gas emissions?
    9·1 answer
  • What does the term "plastic" mean when saying that "the mantle is plastic"?
    7·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How do the sun and moon affect the tides?​
    9·1 answer
  • How do organism survive in death Valley, California?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!